The Tubes

the test tube, and observations are recorded. Go to next lab and come back and record observations Part B #3 a sample of 10ml copper (II) sulfate is obtained, then places in a test tube and recorded the observations. A 10ml of potassium carbonate was placed into a test tube to be observed and recorded. The two solutions are mixed and the observations were recorded. Go to next lab and come back and record observations Part C #5 A sample of 15ml of hydrogen peroxide is placed into a test tube. A…

Introduction Chlorella vulgaris is known to date back more than 2.5 billion years. C. vulgaris is a unicellular green algae that is eukaryotic (Wells). Because of its long life on earth it has been essential for C. vulgaris to evolve so it can survive. One feature that C. vulgaris has is its ability to grow rapidly. Because of its rapid growth scientist have been studying it and found that it can be used in many different ways; wastewater treatments, production of protein-rich food and feed…

available. The organism that we studied was germinating mung bean seeds. We used a system called respirometer which includes a test tube that is to be filled with the seeds until approximately 3 cm before the top. Other parts that were included was the syringe, and a 1ml pipette, with both the syringe and the pipette threaded through a cork cap that is placed onto the test tube. We are trying to measure the respiration rate. We achieved this by using the respirometer with the syringe fully…

culture and place it in a clean test tube labeled 1, 1:1 concentrated yeast sample. We transferred 4 ml of the yeast culture from tube 1 and place it in a second test tube, then dilute it with 4 ml of DI H2O, labeled 2, 1:2. We transferred 4 ml of yeast culture from tube 2 to another clean test tube, labeled 3, 1:4 and dilute it with 4 ml of DI H2O. We did the same thing with tube #4, labeling it 4, 1:8. We will take 4 ml from tube 4 and place it in a 5th test tube, labeling it 5, 1:16. W mixed…

To lower your risk of infection: ○ Your health care team will wash or sanitize their hands. ○ Your skin will be washed with soap. ○ Hair may be removed from the surgical area. • An IV tube will be inserted into one of your veins. Medicine will flow directly into your body through the IV tube. • You will be given one or more of the following: ○ A medicine to help you relax…

To begin the experiment, the Spec 20 was turned on to warm up for 15 minutes and set to maximum absorbance wavelength. Ten test tubes were then prepared. The Spec 20 was set to 0% and a test tube of blank solution (water) was wiped off and placed into the Spec 20. Transmittance was then set to 100% to calibrate the machine. Next, five test tubes were prepared and labeled with one of the standard solutions of 0.05 M, 0.1 M, 0.2 M, and 0.5 M CuSO4 in them. The Spec 20 was set to 600 nm and %…

of water is added to the test tube is marked; then the distance between the two markings are measured which represents 1cm3. The test tube is mark at the same distance, the test tube is marked to the appropriate number. 1cm 3 of yeast cell suspension is placed into the marked test tube using a pipet which is emptied from the water. 2cm 3 of hydrogen peroxide solution is placed into another test tube using a pipette. Both test tubes are placed in a water bath test tube rack which is maintained…

solutions to each test tubes were labeled. Then, add 2 mL of Benedict 's reagent to each large test tubes and the initial appearance of each solution in the test tubes will be recorded. Then we place each test tubes that add the Benedict 's solution into the hot boiling water and waiting for 5 minutes to get the results. After 5 minutes, take all the test tubes that have Benedict 's out of the hot boiling water and wait for a minute let them be cold. Then shake all the test tubes were cold to…

in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained…

designed to test the students’ skills and knowledge of performing biochemical tests learned during the course of the lab. Students receive a numbered tube containing a mixed culture of two unknown organisms and are required to determine the identity of each microorganism by performing a series of biochemical tests of their choice. Unknown test tube #25 was obtained and streaked onto two agar plates to obtain individually isolated colonies. The gram-staining procedure was used to determine…