Intron

Differential alternative splicing human tissue network analysis of GUK1 Result Figure 4.12: Visualisation of alternative splicing gene GUK1 in human tissues. Differential alternative splicing genes between two different tissues comparison were shown on a different visualisation platform and tools in comparison with network analysis. (A) rMATS analysis. Histogram shows inclusion level ψ, per sample for each tissue comparisons. In this case, only exon 3 found as statistically alternative splicing significance of skipped exon (SE) in both tissue comparisons; heart vs. liver and brain vs. liver. The inclusion level in the heart is 0.9 and 0.35 in the liver for tissue comparison heart vs. liver; while inclusion level in the brain is 0.83 and 0.28 in the liver for tissue comparison brain vs. liver. (B) Vials – visualising alternative splicing of genes. Data shows here is from the Illumina BodyMap 2.0. There are three views which are junction view, isoform abundance view and expression view. For each row in the isoform abundance view represent a particular isoform. Dark bar represents the exon that is included whilst the greyed out area represents the full spectrum of that exon’s splicing. A dot plots showing abundance for each tissue and for junction view show the junction reads. Dot plots show the abundance of junction support. Three tissues of brain, heart and liver were selected and multiple dot plots shown to allow comparison between these tissues. Different tissues show…

I. Introduction to The C-Value Paradox C-Value is defined as “the amount of DNA per haploid cell or the number of kilobases per haploid cell at any given time” (Swift 1950). The C-Value Paradox states that C-Value or genome size does not always equal the number of genes contained within the genome or complexity of the organism. Order of magnitude is when more DNA than what is necessary to encode for proteins. The prokaryotic genome is much simpler than the complex genome of the eukaryote yet…

also impacts translation efficiency and stability of mRNA. Non-Coding Regions of DNA Introns are portions of a gene that do not code for amino acids, while exons do code for amino acids and contribute to the production of proteins (ghr intron). In the cells of plants and animals, most gene sequences are broken up by introns, which lay in between the expressed regions, exons. During protein synthesis, non-coding sequences of DNA are removed from mature messenger RNA prior to translation. DNA that…

Question 1: a) A: Promoter B: Splice site C: 5’ UTR D: Start codon E: Stop codon F: 3’ UTR b) The sum of the exons and introns (all in kilobases) (1.2+8+0.7+27+0.4+11+3.1) = 51.4 kb. c) The sum of the exons (all in kilobases) (1.2+0.7+0.4+3.1) = 5.4 kb. d) RNA Protein Truncation mutation in exon 2 Same length, same amount of RNA produced. Shorter in length (due to earlier stop codon), same amount of protein produced, usually changes the protein to non-functional, though not always. 3bp in…

the disease since it is rare and is one type of muscular dystrophies many forms. Symptoms are seen through motor delays in childhood development. DMD main symptom is increased muscle-weakness overtime. Each case of DMD is different. The first muscles that weaken are usually the upper arms and upper legs. Early identification by medical professionals of DMD allows children to gain assess, knowledge, and resources for living with the disease. New gene therapies are the new frontier for DMD…

differences of gene expression between these two types of cells. A key difference between Eukaryotes and Prokaryotes is that Eukaryotes contain monocistronic mRNA molecules, meaning that the molecule will only code for cistron, and henceforth one protein. Conversely, Prokaryotic mRNA is polycistronic. This means that one mRNA molecule codes for multiple cistrons, resulting in the production of many proteins upon translation. Proteins produced from this polycistronic mRNA will likely have related…

uracil replaces thymine. Had this DNA been in a eukaryotic cell, the process would not have been quite so simple. At termination, there would have been a polyadenylation signal sequence. About 10-35 nucleotides later, the RNA would be cut loose and transcription would end. In a eukaryote, the process wouldn’t have ended yet. Now, it would be time for RNA processing, the modification of pre-mRNA, also known as the primary transcript, before it is sent out into the cytoplasm. First, a…

PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX,…

polymerase does not go easily along a DNA molecule, the RNA goes through another phase before maturation. Transcription is only the first step in a sequence of reactions that consist of the covalent alteration of both ends of the RNA and the deletion of intron sequences that are deleted from the center of the RNA transcript by the process of RNA splicing. According to the textbook “Biology”, particles called small nuclear ribonucleoprotein particles abbreviated as snRNPs (pronounced “snurps”)…

this product is finalized with molecular machinery that will selectively cut out portions of mRNA (introns) and, conversely, link together other segments (exons) (Matlin 2005). Alternative splicing in which different combinations of splice sites of a mRNA molecule can be joined to each other, has become the rule of the translational process, rather than the exception. Through GENOME TILLING microarrays, it has been shown that alternative splicing occurs in greater than 80% of the genes found in…