DNA

    Page 9 of 50 - About 500 Essays
  • Plasmid Purification Lab Report

    Purification and Quantitation of DNA and Plasmid Structure Labs 3 and 4 Biology 453 Clayton Pedigo September 14 and 21, 2016 Introduction: In this report, there are two labs being discussed. The first lab being lab 3 (purification and quantitation of plasmid DNA) involved lysing bacterial E.coli cells and retrieving the plasmid particles. The purpose of the second lab, lab 4 (plasmid DNA structure), was to use the concentrated DNA from lab 3 and compare…

    Words: 1544 - Pages: 7
  • Selective Breeding Research Paper

    process of altering an existing gene in the DNA and inserting it into cells in an organism to fix genetic disorders or diseases. In humans, gene therapy is the process in which some of the defect cells or the cells carrying the disease are removed from the body (eg. lung cells in a Cystic Fibrosis patient) in order to harvest their DNA. The base sequence of their DNA is then altered to remove the genetic disorder by deconstructing and reconstructing DNA through techniques such as PCR, ligation…

    Words: 2597 - Pages: 11
  • Deoxyribonucleic Acid Synthesis

    Deoxyribonucleic Acid better known as DNA is housed in the cell’s nucleus where the genetic material is. DNA is a long molecule that forms a double helix, folded inside of the nucleus of the cell. The double strand of DNA is held together by hydrogen bonds. The double helix of DNA run head to tail. DNA is typically millions of base pair long (Shier, Butler, Lewis, 2016, p.94). Deoxyribonucleic Acid is one type of nucleic acid with the sequence of building blocks that hold information that…

    Words: 717 - Pages: 3
  • Polymerase Chain Reaction Essay

    with Michael smith, for his contribution in site-mutagenesis. Kary was working as a chemist at the Cetus Corporation, a biotechnology firm in Emeryville, California, where he came across an idea to amplify a desired DNA strand generating thousands to millions of copies of an interested DNA sequence (Mullis, 1998). The enhancement made by Kary Mullis enable PCR to become a principal technique in biochemistry and molecular biology (Rabinow et al, 1996). The technique comprises…

    Words: 1738 - Pages: 7
  • Influence Of Genetic Differences In Living Organisms

    chromosomes, each of these chromosomes are a housing unit for DNA. DNA, also known as deoxyribonucleic acid, is a simple molecule found in all living organisms. DNA has a unique structure, made up of a double helix, base pairing, and hydrogen bonding, all working together to make it stable. The double helix is made up of a phosphate backbone. These phosphates create a bond between the sugars and themselves,…

    Words: 1415 - Pages: 6
  • Unit 18 Genetics: Questions And Answers

    Task 1. Deoxyribonucleic acid (DNA for short) is genetic material that carry’s the majority of information for development growth and many other functions. DNA is located in the nucleus of a cell. DNA has a double helix structure and is formed by a series of bases these are Adenine , Cytosine , Guanine and Thymine. These bases have a basic pattern when forming DNA. Adenine will only join to Thymine when in DNA and Cytosine will only join to Guanine when in DNA. These bases are bonded by…

    Words: 782 - Pages: 4
  • Differentiating The Mycosphaerella Eumusae

    AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color. The LAMP amplified products also produced a ladder-like pattern in the gel electrophoresis. This indicated the amplification of target pathogen M. eumusae by the designed LAMP primers (Fig. 2). Optimization of LAMP reaction During the LAMP optimization process, the effects of Mg2+ concentration, the amount of Bst DNA polymerase, the effect…

    Words: 1752 - Pages: 8
  • Fingerprinting In Forensics

    determination by slab gel electrophoresis. Forensic DNA analysis was introduced in the 1980s and became established with the discovery of polymorphic mini-satellites or variable number of tandem repeat (VNTR) loci which gave rise to the concept of genetic fingerprinting in forensic science (Gill, Jeffreys and Werrett, 1985). This changed emphasis from gene product…

    Words: 948 - Pages: 4
  • Restriction Enzymes In Biology Essay

    are used to manipulate DNA sequences to create recombinant DNA by first cutting up the foreign DNA in order to protect the bacteria cell against invading DNA from other organisms. The enzyme is very specific when it comes to identifying a specific DNA sequence. When the enzyme identifies the specific DNA sequence it cuts both DNA strands at specific points at the restriction site. Lastly, the DNA ligase joins the DNA from two different sources and produces a recombinant DNA molecule by…

    Words: 1459 - Pages: 6
  • Deoxyribonucleic Acid Research Paper

    Ribonucleic acid, the molecule formed in the transcription of DNA, is made up of phosphate, ribose, and adenine, guanine, cytosine, and uracil. The backbone of DNA consists of a phosphate bonded to a deoxyribose molecule. Deoxyribose is a sugar containing five carbons, and it is called deoxyribose as it is missing an oxygen atom on C2. The sugar found in RNA is oxygenated at this carbon, and is called ribose. The nucleotides of DNA are linked with phosphates at the 3' and 5' ends of the…

    Words: 651 - Pages: 3
  • Page 1 6 7 8 9 10 11 12 13 50

Related Topics:

Popular Topics: