Pcr Amplification : Dna Amplification Essay example

742 Words Dec 5th, 2016 3 Pages
PCR Amplification
Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5 min., 95°C for 30 sec, 60°C for 30°sec, 72°C for 1 min, repeat previous 3 steps 29 times, 72°C for 1 min and then hold at 4°C. PCR tubes were then stored in -20°C freezer boxes for subsequent experiments.
Restriction Enzyme Digest
Restriction enzymes Xho1/Nde1 (Fermentas, Life Technologies) were used for double digest reactions and Pvu1 (Fermentas, Life Technologies) was used for single digest reactions. Plasmid single digest reactions were completed in micro-centrifuge tubes and contained 0.5U/µL Puv1, either 100ng/µL pET26b or pET26b-folA plasmid DNA, and 1X restriction enzyme…

Related Documents