Joinville Stroke Registry Case Study

Improved Essays
Joinville is a city located in Southern Brazil with 516,288 inhabitants, according to the last national census. The Joinville Stroke Registry is an ongoing population-based registry databank started in 2005 and supported by law since 2013. The registry uses the methodology proposed by Sudlow and Warlow as well as the Stroke-Steps modular program proposed by the WHO (first step for all hospital cases, second step for checking of death certificates and third step to ascertain mild events). The detailed methods of cohort recruitment and data collection procedures have been previously described (7), the Joinville Stroke Registry is associated to Joinville Stroke Biobank, which storage DNA samples from all patients of Joinville Stroke Registry. The baseline characteristics for all patients and controls included in study are shown in Table 1.

Ethical considerations
The study was approved by the Institutional Ethical Review Board under protocol number 1.396.172.

Inclusion Criteria
Cases include, ischemic strokes (IS) subtypes LAAS and CE classified according to the modified Trial of Org 10172 in Acute Stroke Treatment (TOAST)
…show more content…
Thereafter, genomic DNA was obtained by the classical “phenol-chloroform” procedure for total DNA extraction. DNA was resuspended in 200 µL of buffer TE (10 mMTris-HCl; 1 mM EDTA; pH 8.0). The purity and yield of DNA extracted were evaluated by spectrophotometry at 260 and 280 nm (Epoch, Biotek Instruments, Winooski, USA). A260/A280 ratios in the range 1.8 – 2.0 were considered for long-term storage. DNA was diluted to a concentration of 10ng/mL before we genotyped the samples. Genotypes were determined by Real Time Polymerase Chain Reaction (qPCR) with employment of TaqMan® probes for the two genetics variants of the study. The reaction was performed using procedures recommended by

Related Documents

  • Improved Essays

    Required Uniform Assignment: Interdisciplinary Care Gary Grant Chamberlain College of Nursing NR340: Critical Care Nursing Required Uniform Assignment: Interdisciplinary Care Background information Demographics: 65-year-old black male; No known allergies; Full code status History of present illness: Patient presents to the Emergency Department with complaints of stroke like symptoms. Patient is visibly weak on the left side and slurred speech. Relevant past medical and surgical history: Patient has a history of hypertension and diabetes.…

    • 1272 Words
    • 6 Pages
    Improved Essays
  • Improved Essays

    Rlt2 Task 4

    • 869 Words
    • 4 Pages

    The current study was a longitudinal study that assessed data from the Health and Retirement Study (HRS). I chose the HRS data because it includes participants that are over the age of 50 and their health status. Age is generally important to the current study because strokes typically occur in older age (Dries & Hussein, 2015). The HRS study began in 1992 and consisted of 12,652 participants that were eligible for interviews and had a response rate of 81.6% (Health and Retirement Study, 2015). This study surveyed individuals over five separate waves, with the last wave consisting of participants that were born between 1948 and 1953 (Health and Retirement Study, 2015).…

    • 869 Words
    • 4 Pages
    Improved Essays
  • Improved Essays

    Purpose: To evaluate the use and efficacy of Stroke Thrombolysis as a treatment in a blocked artery that has caused ischemic stroke. Description of Pathology: Ischemic strokes account for 87% of all stroke incidents, making this type of stroke the most common. Ischemic strokes occur as a result of a blood clot plugging or obstructing an artery carrying blood to the brain. This keeps oxygen and nutrient rich blood from flowing into the brain.…

    • 553 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Lac Operons

    • 1587 Words
    • 6 Pages

    The nucleotide sequences for the wild type DNA and the mutant DNA, pLac/WT and pLac/m2, where aligned and compared to uncover any mutations. The locations of the CAP binding site, promoters, operator, and coding region needed to be highlighted and marked on the nucleotide sequences. The CAP binding site is located 105-116 on the nucleotide. Promoter -35 can be found from 140 to 145 on the sequence. The Promoter -10 is found from 164-169.…

    • 1587 Words
    • 6 Pages
    Improved Essays
  • Improved Essays

    Stroke Alert Team Paper

    • 550 Words
    • 3 Pages

    The implementation of a Stroke Alert Team at St. Vincent’s Medical Center is a cost-effective way to ensure patients who present with symptoms of an acute stroke are quickly assessed and treated. It also assures that the organization will continue to sustain high performance for the stroke Core Measure sets. The Stroke Coordinator will play a vital role in the workflow discovery and the plan to develop an interprofessional Stroke Alert Team. The Stroke Alert Team members include: A designated ED MD and Charge RN, the ED Radiologist, the Neurologist on call, and the Stroke Coordinator. EMS will notify the ED of a possible stroke.…

    • 550 Words
    • 3 Pages
    Improved Essays
  • Decent Essays

    2.1.3 Experiment tool kits Quantification PCR Power SYBR Green PCR Master Mix (Applied Biosystems #4368702) Real-time PCR TaqMan Reverse Transcription Kit (Applied Biosystems) DNA Extraction AxyPrep Midi and Maxi Plasmid Kits (Axygen #AP-MN-P50), Nucleobond Xtra midi (Nucleobond #E1910) Reporter Gene Assay Luciferase Assay Kit (Promega #1910)…

    • 46 Words
    • 1 Pages
    Decent Essays
  • Improved Essays

    PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5…

    • 742 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    CINAHL Is User Friendly

    • 199 Words
    • 1 Pages

    (2014). Most important outcomes research papers on stroke and transient ischemic attack. Circulation: Cardiovascular Quality and Outcomes, 7, 191-204.…

    • 199 Words
    • 1 Pages
    Improved Essays
  • Improved Essays

    a.) The symptoms displayed by Mary, including weakness/paralysis of the left arm, slurred speech, and unusual facial expression. The paralysis of the left arm indicates a problem in the part of the central nervous system that controls motor functions. The slurred speech indicates a neurological issue. Finally, the unusual expression indicates weakness within the facial muscles.…

    • 502 Words
    • 3 Pages
    Improved Essays
  • Decent Essays

    The Apollo Market Health Fair was held on October 29th Sharpstown high school. The goal of this health fair was to help inform families about various disease states in order to present a big picture of living an overall healthy lifestyle. At this event we had our Diabetes, Power to End Stroke, Remember the Ribbon, and Chronic Kidney Disease initiatives present. Here are a couple of words from some of the initiative members.…

    • 501 Words
    • 3 Pages
    Decent Essays
  • Improved Essays

    Massage Therapy

    • 635 Words
    • 3 Pages

    The leading cause of long term disability in the United States is stroke, and one American dies from stroke about every four minutes. Stroke by definition is the sudden death of brain cells due to lack of oxygen. The main types of stoke are hemorrhagic, ischemic, and a transient ischemic attack. Hemorrhagic stroke is broken in to two types, and the most common is the intracerebral hemorrhage, when an artery in the brain bursts flooding the brain with blood. The second and less common subarachnoid hemorrhage, when bleeding occurs in the area between the brain and the thin tissue that covers it.…

    • 635 Words
    • 3 Pages
    Improved Essays
  • Superior Essays

    Hemorrhagic Stroke Essay

    • 1061 Words
    • 4 Pages

    Overview Stroke and hemorrhagic stroke A stroke is a brain attack. It is caused when blood flow to an area of brain is cut off. Brain cells are deprived of oxygen and begin to die. After that, abilities for the brain cells in that area to memory and muscle control are lost.…

    • 1061 Words
    • 4 Pages
    Superior Essays
  • Superior Essays

    For each group cDNA was synthesized from 500 ng of RNA using Maxima Universal First Strand cDNA Synthesis kit (Thermo Scientific, catalogue no-K1661) and consecutively 50 ng of cDNA was used for quantitative real time PCR assay. cDNA was amplified in a thermal cycle (CFX96 PCR system, BioRadLaboretories) in 20 µl reaction mixture containing 0.5 µl cDNA template (50 ng), 12.5 µl Maxima SYBR green/fluorescent qPCR master mix (2X, Thermo Scientific), 0.3 µl forward and reverse primer (100 pmol), 6.4 µl nuclease free water. The details of primer sequences, sizes of PCR products, and the annealing temperature are listed in Table-1. PCR amplification was carried out with initial denaturation at 95 °C for 2 min followed by 40 cycles of amplification for 30 s at 94 °C, annealing for 45 s at respective primer annealing temperature and extension for 45 s at 72 °C followed by final extension at 72 °C for 10 min.…

    • 1514 Words
    • 7 Pages
    Superior Essays
  • Improved Essays

    Stroke is a medical condition in which blood supply to part of the brain is cut off causing brain to damage (Stroke, 2005). One of the biological factor that could lead to stroke is ethnicity as people who are African-Caribbean, South Asian are likely to develop diabetes and high blood pressure which can cause stroke (Stroke, 2005). One of the social factor that influence stroke is physical inactivity as this can lead to risk of high blood pressure, cholesterol level and diabetes which can lead to obesity (American Stroke Association- 2012). One of the psychological factor that can leads to stroke is Depression as people who are depressed tend to a have unhealthy habit such as smoking, lack of physical activity and Some of the medication used to treat depression has also been linked to cause stroke (Hu et al, 2011).…

    • 1095 Words
    • 5 Pages
    Improved Essays
  • Improved Essays

    Mungbean Case Study

    • 1050 Words
    • 5 Pages

    Extraction of DNA could be done from any samples but fresh samples are the best for extraction for good quality DNA. There are many protocols in extracting DNA which are simple, quick, less laborious and less time consuming which produce high quality and quantity of DNA e.g. QIAGEN RNeasy. There are different types of molecular markers and they are grouped by Semagn et al., 2016 based on their method of analysis (Hybridization-based molecular markers or PCR-based molecular markers). Molecular markers are also used to detect the genomic structure of different organisms, genotypic variations such as insertions, mutations, deletions and single nucleotide polymorphisms, genome organization and evolutions (Jones et al., 2009). In many crop breeding programmes, these markers are used to track loci and genomic regions which are strongly linked with a large number of agronomic and disease resistance traits found in crop species (Varshney et., 2007).…

    • 1050 Words
    • 5 Pages
    Improved Essays