Results
Primer design and LAMP reaction
Among 40 different primers (OPA 1-20 & OPB 1-20 series) screened by RAPD PCR for differentiating the Mycosphaerella eumusae from other leaf spot causing fungal pathogens in banana, only the primer OPB 10 has generated a unique amplicon specific to M. eumusae at 1300 bp size. A total of nine different sets of LAMP primers were designed based on this specific SCAR derived RAPD marker sequence of M. eumusae and screened for the production of LAMP products (Fig. 1). Out of nine sets of primer screened, only one set of forward and backward inner primers viz., FIP1L-GTCTGGAAGCACGCCAATCTGT-TACTTGAAGGCATGCACCAC and BIP1L- TTCGCAACCTCATCGACGTTGT-TCCAGTACTCATTGGCCTCC along with outer primers F3- GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color. The LAMP amplified products also produced a ladder-like pattern in the gel electrophoresis. This indicated the amplification of target pathogen M. eumusae by the designed LAMP primers (Fig. 2).
Optimization of LAMP reaction
During the LAMP optimization process, the effects of Mg2+ concentration, the amount of Bst DNA polymerase, the effect of addition of betaine and the reaction temperature …show more content…
eumusae. The initial DNA concentration used was 10,000 ρg/µl. The results showed that the LAMP method detected the genomic DNA of M. eumusae at a very low concentration of 1 ρg/µl of DNA (Fig. 4a). The conventional PCR performed using the outer primers F3 and B3 detected the genomic DNA of M. eumusae only up to 1000 ρg/µl concentration by producing an amplicon size of 200 bp in agarose gel electrophoresis (Fig.4b). Thus, it can be inferred that the sensitivity of LAMP method was 100 fold higher than that of the conventional
Primer design and LAMP reaction
Among 40 different primers (OPA 1-20 & OPB 1-20 series) screened by RAPD PCR for differentiating the Mycosphaerella eumusae from other leaf spot causing fungal pathogens in banana, only the primer OPB 10 has generated a unique amplicon specific to M. eumusae at 1300 bp size. A total of nine different sets of LAMP primers were designed based on this specific SCAR derived RAPD marker sequence of M. eumusae and screened for the production of LAMP products (Fig. 1). Out of nine sets of primer screened, only one set of forward and backward inner primers viz., FIP1L-GTCTGGAAGCACGCCAATCTGT-TACTTGAAGGCATGCACCAC and BIP1L- TTCGCAACCTCATCGACGTTGT-TCCAGTACTCATTGGCCTCC along with outer primers F3- GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color. The LAMP amplified products also produced a ladder-like pattern in the gel electrophoresis. This indicated the amplification of target pathogen M. eumusae by the designed LAMP primers (Fig. 2).
Optimization of LAMP reaction
During the LAMP optimization process, the effects of Mg2+ concentration, the amount of Bst DNA polymerase, the effect of addition of betaine and the reaction temperature …show more content…
eumusae. The initial DNA concentration used was 10,000 ρg/µl. The results showed that the LAMP method detected the genomic DNA of M. eumusae at a very low concentration of 1 ρg/µl of DNA (Fig. 4a). The conventional PCR performed using the outer primers F3 and B3 detected the genomic DNA of M. eumusae only up to 1000 ρg/µl concentration by producing an amplicon size of 200 bp in agarose gel electrophoresis (Fig.4b). Thus, it can be inferred that the sensitivity of LAMP method was 100 fold higher than that of the conventional