Mycosphaerella Eumusae Case Study

1752 Words 8 Pages
Results

Primer design and LAMP reaction

Among 40 different primers (OPA 1-20 & OPB 1-20 series) screened by RAPD PCR for differentiating the Mycosphaerella eumusae from other leaf spot causing fungal pathogens in banana, only the primer OPB 10 has generated a unique amplicon specific to M. eumusae at 1300 bp size. A total of nine different sets of LAMP primers were designed based on this specific SCAR derived RAPD marker sequence of M. eumusae and screened for the production of LAMP products (Fig. 1). Out of nine sets of primer screened, only one set of forward and backward inner primers viz., FIP1L-GTCTGGAAGCACGCCAATCTGT-TACTTGAAGGCATGCACCAC and BIP1L- TTCGCAACCTCATCGACGTTGT-TCCAGTACTCATTGGCCTCC along with outer primers F3- GCTCGAGCGAAGATGAAAGT
…show more content…
It was observed that, when the optimum reaction temperature of 65 °C, the incubation time of 60 min, 2.5 U of Bst DNA polymerase, 0.48 μM of FIP and BIP, 0.12 μM of F3 and B3 primer, 6 mM MgSO4 concentration and 0.5 M betaine was used in the LAMP reaction mixture, the color of LAMP products containing the target pathogen M. eumusae turned into yellowish green from its original orange color and also showed a more intense ladder like patterns in the gel. It was also noted that, the addition of MgSO4 at a concentration of 6 mM is a crucial step in the LAMP method as any deviation from this concentration might not result in the accurate amplification of the target …show more content…
For example, Tomlinson et al. (2010) designed LAMP primers based on the intergenic spacer of nuclear ribosomal DNA (rDNA) for detection of Botrytis cinerea. Zhang et al. (2013) designed LAMP primers from the sequences of intergenic spacer (IGS) region of the nuclear ribosomal operon for the detection of Fusarium oxysporum f. sp. cubense Tropical Race 4 in banana cultivated soil samples. Similarly, Mohammed Amin (2013) designed LAMP primers based on the sequences of 28s ribosomal RNA gene and reported that LAMP reaction could successfully detect Fusarium oxysporum f. sp. lycopersici. In our present study, LAMP primers were designed from the specific SCAR marker sequence of M. eumusae derived from RAPD analysis. The designed LAMP primers (F3, B3, FIP 1L and BIP 1L) have successfully detected the target pathogen M. eumusae from DNA samples of M. eumusae and single leaf spot tissues. It was also observed that, there was no cross reaction with the other closely related Mycosphaerella pathogens such as M. fijiensis and M. musicola and 17 other leaf spot fungal pathogens that attacks banana. Thus, the LAMP primers greatly proved their high specificity towards M.

Related Documents