Results
Primer design and LAMP reaction
Among 40 different primers (OPA 1-20 & OPB 1-20 series) screened by RAPD PCR for differentiating the Mycosphaerella eumusae from other leaf spot causing fungal pathogens in banana, only the primer OPB 10 has generated a unique amplicon specific to M. eumusae at 1300 bp size. A total of nine different sets of LAMP primers were designed based on this specific SCAR derived RAPD marker sequence of M. eumusae and screened for the production of LAMP products (Fig. 1). Out of nine sets of primer screened, only one set of forward and backward inner primers viz., FIP1L-GTCTGGAAGCACGCCAATCTGT-TACTTGAAGGCATGCACCAC and BIP1L- TTCGCAACCTCATCGACGTTGT-TCCAGTACTCATTGGCCTCC along with outer primers F3- GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color. The LAMP amplified products also produced a ladder-like pattern in the gel electrophoresis. This indicated the amplification of target pathogen M. eumusae by the designed LAMP primers (Fig. 2).
Optimization of LAMP reaction
During the LAMP optimization process, the effects of Mg2+ concentration, the amount of Bst DNA polymerase, the effect of addition of betaine and the reaction temperature and time were tested. It was observed that, when the optimum reaction temperature of 65 °C, the incubation time of 60 min, 2.5 U of Bst DNA polymerase, 0.48 μM of FIP and BIP, 0.12 μM of F3 and B3 primer, 6 mM MgSO4 concentration and 0.5 M betaine was used in the LAMP reaction mixture, the color of LAMP products containing the target pathogen M. eumusae turned into yellowish green from its original orange color and also showed a more intense ladder like patterns in the gel. It was also noted that, the addition of MgSO4 at a concentration of 6 mM is a crucial step in the LAMP method as any deviation from this concentration might not result in the accurate amplification of the target pathogen. Detection of M. eumusae from fungal mycelium The LAMP primers set (F3, B3, FIP1L and BIP1L) used in this study amplified the target genomic DNA of 105 isolates of M. eumusae (99 isolates from eight different states of India and six isolates from other countries). The LAMP amplified products showed a color change from orange to yellowish green and a visible ladder-like DNA patterns in the agarose gel electrophoresis for all the M. eumusae isolates (105 nos.) tested (Table 1). Detection of M. eumusae from single leaf spot tissues The primers used in LAMP method amplified the target genomic DNA of M. eumusae from 99 different leaf spot tissues obtained from different banana growing states of India. Besides, the LAMP primers designed showed positive reaction only for the DNA of M. eumusae extracted from leaf spot of varying sizes (stages 4-6) and showed negative reaction for DNA from healthy leaf spot tissues (Table 2). These results indicated that the LAMP primers designed in this study were able to detect and diagnose the M. eumusae present in the leaf spot tissues. Specificity of LAMP method The specificity of LAMP primer tested using the genomic DNA of some non target organisms such as the closely related Mycosphaerella species [M. fijiensis (10 nos.) and M. musicola (10 nos)] and 17 other leaf spot causing fungal pathogens resulted in the amplification of only the target DNA of M. eumusae by turning the color of the LAMP amplified product into yellowish green and produced a ladder-like DNA pattern in gel electrophoresis. In all the other tubes containing the non target organisms and non template control, the original orange color was retained and the LAMP products doesn’t show any ladder-like DNA pattern in gel electrophoresis (Table 1). …show more content…
eumusae. The initial DNA concentration used was 10,000 ρg/µl. The results showed that the LAMP method detected the genomic DNA of M. eumusae at a very low concentration of 1 ρg/µl of DNA (Fig. 4a). The conventional PCR performed using the outer primers F3 and B3 detected the genomic DNA of M. eumusae only up to 1000 ρg/µl concentration by producing an amplicon size of 200 bp in agarose gel electrophoresis (Fig.4b). Thus, it can be inferred that the sensitivity of LAMP method was 100 fold higher than that of the conventional
Primer design and LAMP reaction
Among 40 different primers (OPA 1-20 & OPB 1-20 series) screened by RAPD PCR for differentiating the Mycosphaerella eumusae from other leaf spot causing fungal pathogens in banana, only the primer OPB 10 has generated a unique amplicon specific to M. eumusae at 1300 bp size. A total of nine different sets of LAMP primers were designed based on this specific SCAR derived RAPD marker sequence of M. eumusae and screened for the production of LAMP products (Fig. 1). Out of nine sets of primer screened, only one set of forward and backward inner primers viz., FIP1L-GTCTGGAAGCACGCCAATCTGT-TACTTGAAGGCATGCACCAC and BIP1L- TTCGCAACCTCATCGACGTTGT-TCCAGTACTCATTGGCCTCC along with outer primers F3- GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color. The LAMP amplified products also produced a ladder-like pattern in the gel electrophoresis. This indicated the amplification of target pathogen M. eumusae by the designed LAMP primers (Fig. 2).
Optimization of LAMP reaction
During the LAMP optimization process, the effects of Mg2+ concentration, the amount of Bst DNA polymerase, the effect of addition of betaine and the reaction temperature and time were tested. It was observed that, when the optimum reaction temperature of 65 °C, the incubation time of 60 min, 2.5 U of Bst DNA polymerase, 0.48 μM of FIP and BIP, 0.12 μM of F3 and B3 primer, 6 mM MgSO4 concentration and 0.5 M betaine was used in the LAMP reaction mixture, the color of LAMP products containing the target pathogen M. eumusae turned into yellowish green from its original orange color and also showed a more intense ladder like patterns in the gel. It was also noted that, the addition of MgSO4 at a concentration of 6 mM is a crucial step in the LAMP method as any deviation from this concentration might not result in the accurate amplification of the target pathogen. Detection of M. eumusae from fungal mycelium The LAMP primers set (F3, B3, FIP1L and BIP1L) used in this study amplified the target genomic DNA of 105 isolates of M. eumusae (99 isolates from eight different states of India and six isolates from other countries). The LAMP amplified products showed a color change from orange to yellowish green and a visible ladder-like DNA patterns in the agarose gel electrophoresis for all the M. eumusae isolates (105 nos.) tested (Table 1). Detection of M. eumusae from single leaf spot tissues The primers used in LAMP method amplified the target genomic DNA of M. eumusae from 99 different leaf spot tissues obtained from different banana growing states of India. Besides, the LAMP primers designed showed positive reaction only for the DNA of M. eumusae extracted from leaf spot of varying sizes (stages 4-6) and showed negative reaction for DNA from healthy leaf spot tissues (Table 2). These results indicated that the LAMP primers designed in this study were able to detect and diagnose the M. eumusae present in the leaf spot tissues. Specificity of LAMP method The specificity of LAMP primer tested using the genomic DNA of some non target organisms such as the closely related Mycosphaerella species [M. fijiensis (10 nos.) and M. musicola (10 nos)] and 17 other leaf spot causing fungal pathogens resulted in the amplification of only the target DNA of M. eumusae by turning the color of the LAMP amplified product into yellowish green and produced a ladder-like DNA pattern in gel electrophoresis. In all the other tubes containing the non target organisms and non template control, the original orange color was retained and the LAMP products doesn’t show any ladder-like DNA pattern in gel electrophoresis (Table 1). …show more content…
eumusae. The initial DNA concentration used was 10,000 ρg/µl. The results showed that the LAMP method detected the genomic DNA of M. eumusae at a very low concentration of 1 ρg/µl of DNA (Fig. 4a). The conventional PCR performed using the outer primers F3 and B3 detected the genomic DNA of M. eumusae only up to 1000 ρg/µl concentration by producing an amplicon size of 200 bp in agarose gel electrophoresis (Fig.4b). Thus, it can be inferred that the sensitivity of LAMP method was 100 fold higher than that of the conventional