Biol 351 Test 2

Front 1

In which compartment(s) does bacterial cell-wall synthesis occur?

Back 1

Cytoplasmic and Periplasmic Membrane

Front 2

Draw the 5 bases of DNA and RNA and lable what is RNA and what is DNA

Back 2

Front 3

What biosynthetic step(s) do bacitracin and penicillin affect? What are the consequences for the cell?

Back 3

interfers with dephosphloration

Front 4

Which component(s) of the peptidoglycan, NAG and/or NAM, are involved in cross-linking?

Back 4

the NAM

Front 5

What stages generally define the synthesis of DNA, RNA, and polypeptide? Which of these major biosynthetic processes require(s) template? Which require(s) primer?

Back 5

transcription yelds RNA
translation yelds poly peptides

DNA requires
-templates
-primer

Front 6

What biosynthetic step(s) do bacitracin and penicillin affect? What are the consequences for the cell?

Back 6

interfers with dephosphloration

Front 7

Which component(s) of the peptidoglycan, NAG and/or NAM, are involved in cross-linking?

Back 7

the NAM

Front 8

What stages generally define the synthesis of DNA, RNA, and polypeptide? Which of these major biosynthetic processes require(s) template? Which require(s) primer?

Back 8

transcription yelds RNA
translation yelds poly peptides

DNA requires
-templates
-primer

Front 9

Can you discriminate the difference between a ribonucleoside and a deoxyribonucleoside?

Back 9

Front 10

What occurs at a replication fork? What are the differences between synthesis of the leading strand and synthesis of the lagging strand?

Back 10

-DNA polymerase III - play a major role on replication
-Topoisomerase - relives the tension generated by unwinding the double helix
-Helicase -unwinds the DNA
-S.S. DNA binding proteins- keeps seperate strands apart
-Primosome- primase that makes short RNA primer and accessory proteins

Front 11

What is the direction of chain-growth in DNA synthesis? RNA synthesis? Polypeptide synthesis?

Back 11

DNA synthesis- 5'-3'
RNA synthesis- 5'-3'
Polypeptide- 3'-5'

Front 12

What is the function of sigma-factor? Rho-factor?

Back 12

the sigma factor- a protein that helps bacterial RNA polymerase core enzymes recognize the promoter @ the start of the Gene. has no catalytic activity
Rho factor- the protein that helps RNA polymerase Dissocate from a Rho-dependent terminator after it has stopped transcription

Front 13

What is meant by the expression, “RNA polymerase holo-enzyme”?

Back 13

A RNA polymerase holo-enzyme is when a Sigma is bound to core enzyme and is a 6 subunit

Front 14

What is the function of prokaryotic promoters and what are their characteristic features?

Back 14

Function: serves as a target for the binding of the RNA polymerase and is not transcribed
Characteristic: 1) A sequence of 6 base (often TTGACA) about 35 base pairs before the Transcription starting point
2)TATAAT sequence, or Pribnow Box, usuallyabout 10 base pairs upstream of the transcriptional start site

Front 15

Are there 3 different types of terminators and what differentiates them?

Back 15

2 Independent events
- release of the polypeptide chain from ribosome
- release of the ribosome from the RNA
Prokaryotic Termination
- UAG(amber)
- UAA(ochre)
- UGA(opal)

Front 16

Are transcription and translation coupled in bacteria? Does transcription begin at a start codon and end at a stop codon? Does translation begin at a start codon? End at a stop codon? Explain.

Back 16

Yes, coupled in bacteria but not in humans
Transcription begins at sigma factor and ends at a terminator
Translation yes begins w/ start codon which is followed by the trailer sequence

Front 17

Using the standard genetic code, find and translate an open reading frame that begins with a start-codon and ends with a stop-codon in the following DNA sequence:
ACCCATGGACTTTCAGTGGAAAC

Back 17

*

Front 18

Using the standard genetic code, make a DNA sequence that could specify the following short coding sequence:Met-Trp-Ser-Arg-Ile-Asp-STOP
How many different codon-choices are there for each of these positions in the coding sequence?

Back 18

*

Front 19

What are the functions of mRNA, tRNA and rRNA? tRNA and elongator-tRNA?

Back 19

mRNA: binds to ribosomes and directs the synthesis of proteins
rRNA: is attributed to ribosomes structure and are also directly involved in the mechanism of protein synthesis
tRNA: must be recognized by aminoacyl tRNA synthetase to add amino acid to tRNA
3'-end
must be recognized by elongation factor alpha to form a complex that interacts with the ribosome
must be recognized by the ribosome to fulfill it's function in polypeptide synthesis

Front 20

What is the functional difference between initiator-tRNA and elongator-tRNA?

Back 20

Initator
-can go to P site
-can intiaite translation @ AUG,GUG,UUU codons in proper contes
Elongator
-can go to A site

Front 21

How does the bacterial ribosome “find” an initiation codon?

Back 21

It begins when initiator N-formylmethionyl-tRNA (fMet-tRNA) binds to a free 30s ribosomal subunit. the 30s subunit posses a molecule of 16s rRNA with nucleotide sequence that are complementary to the Shine-Dalgarno sequence in the leader sequence of mRNA

Front 22

What are the A, P, and E sites of the ribosome?

Back 22

Psite: is the donor site or peptidyl
Asite: the Aminoacyl or acceptor site
Esite: the exit site

Front 23

What is the major function of the small ribosomal subunit?

Back 23

associated initiation factors bind @ the ribosome binding site to form a initation complex

Front 24

What is the major function of the large ribosomal subunit?

Back 24

Binds, initiation factors leaves and translation initates

Front 25

What is the difference between elongation and termination in bacterial polypeptide synthesis?

Back 25

Elongation: synthesis from the first to last peptide bond
Termination(2 independent events)
-release of the polypeptide chain from the ribosome,
-release of the ribosome from the mRNA

Front 26

Diagram regulation of the lac operon in response to an inducer such as lactose.

Back 26

If Lactose is present then the Lac Operon is working to break down the lactose
If NOT PRESENT then its not working

Front 27

Diagram regulation of the trp operon in response to tryptophan.

Back 27

If trp is not present then the trp operon begins to make trp and if trp is present thenthe trpoperon dosent make any

Front 28

What is the role of cAMP and CAP in regulation of bacterial gene regulation in response to glucose? How do they function?

Back 28

Glucose negatively regulates Lac and other operons through cAMP-CAP control
- cAMP cant work if there is glucose so cAMP wait's till glucose is gone & CAP is the big structure thatcAMP binds to &when they bind the Lac Operon begins to work. when there's alot of glucose LacO won't wrok
- Glucose High[cAMP] Low
Glucose low [cAMP] High

Front 29

What is the function of an “operator” site? How does its function affect gene expression?

Back 29

Operator sites control operon expression by binding to repressors or to activators

Front 30

What is the definition of horizontal gene transfer? Explain how it differs from vertical gene transfer.

Back 30

The process by which genes are transfered from one mature indepent organism to another. the mechanism for this in prokaryotes is transformation, conjugation and transduction
Vertical gets it's gens from an ancestor while Horizontal get's it's gens from another organism whitout being its offspring

Front 31

What organism was Griffith studying when he discovered transformation?

Back 31

Streptococcus pheumoniae

Front 32

Describe Griffith's experiment.

Back 32

Injected mice with heat killed pathogenic S and live nonpathogenic R stains
- mice killed
Analyses of bacteria in mouse blood showed living S
- concluded that living R was transformed to living S

Front 33

Explain how Avery, Macleod, and McCarty used transformation to demonstrate that the genetic material was DNA.

Back 33

Removed proteins, lipids, polysaccharides, ribonucleic acids from extracted by chemical and or enzymatic methods
- no effect on transformation
purify DNA from R strand that was transformed to S and used that DNa to transform Naive R strain
- concluded that DNA was the hereditary material

Front 34

Explain the difference between the donor and recipient cell in transformation.

Back 34

Donor give DNA
Recipient incorporaties the DNA in it's chromosome

Front 35

List the steps in the process of DNA uptake by naturally competent cells.

Back 35

*

Front 36

What is the difference between an endonuclease and an exonuclease?

Back 36

-The DNA is cleaved by endonuclease to double stranded fragments about 5-15 kilobases long
- one strand is hydrolozied by another envelope assoicated endonulease durring uptake; the other strand associated with the small proteins & moves through the plasma membrane

Front 37

Most bacterial organisms are not naturally competent, but it is possible to use artificial methods of transformation to introduce plasmid DNA into these organisms. What are two methods used for artificial transformation of E. coli?

Back 37

1) treatment of cells with calcium chloride necessary for transformation
2) electroporation has became the more favored method for transforming E.coli

Front 38

During natural transformation of Bacillus subtilis does the DNA uptake machinery bind to single- or double-stranded DNA? What is the form of the DNA taken up into the cell? is it single-stranded or double-stranded?

Back 38

The machine binds to double stranded DNA But single stranded DNA is taken into the cell

Front 39

What is a conjugative plasmid?

Back 39

They are plasmids that can transfer copies of themselves to other bacteria durring the process of conjugation

Front 40

Explain how the U-tube experiment showed that conjugation requires cell-cell contact.

Back 40

The U-tube experiment was that 2 different strands of E.coli were inoluclated in the tube with a filter allowed the mediam & DNA molucules to pass but not the cells so after being moved back & forth they plated the media & found no cell growth this was due to the fact that the 2 types of cells were not in contact w/ each other not allowing any gene transfer via the sex philius

Front 41

What is the phenotype of a Met- auxotroph?

Back 41

*

Front 42

What is the difference between an F+ and an F- E. coli cell?

Back 42

F+ means Fertile
F- means non-fertile

Front 43

What is the name used for bacterial cells where the F plasmid has integrated into the bacterial chromosome?

Back 43

Hfr conjugated

Front 44

Explain how the donor-recipient mating pairs form during F-mediated conjugation.

Back 44

The sex pilus extends from the F+ cell ti tge F- cell then sex pilus contracts bringing the 2 cells closer F+ cell prepairs for DNA transfer by assembeling type 4 secretion apparatus

Front 45

Explain the difference between an F plasmid and an F' plasmid.

Back 45

F plasmid- has no bacterial gene's in it while F' plasmid took some of the Bacterial genes when excision was taking place

Front 46

Conjugation is the mechanism used by self-transmissable plasmids to move to a new bacterial host cell. Sometimes bacterial genes can be transferred during conjugation.
a) Explain how bacterial genes are transferred to the recipient cell by an Hfr donor strain.
b) Explain how bacterial genes are transferred to the recipient cell by an F' donor cell.

Back 46

Hfr Donorstrain has recombinant DNA. Hfr strains transfer bacterial genes to recipents b/c the F factor is integrated into the host chromosome. A complete copy of the Ffactor is often not transfered
F' dosent have recombinant DNA F' readly transfers these genes to other bacteria

Front 47

What is the definition of transduction?

Back 47

the Transfer of genes between bacterial of Archaeal cells by viruses

Front 48

What is a prophage?

Back 48

the latent form of a temperate phage that remains within the lysogen, usually integrated into the host cell

Front 49

Explain the difference between a temperate phage and a lytic phage.

Back 49

Temperate phage- Bacteriophage that can infect bacteria and establish a lysogentic relationship rather than immediately lysing their host

Front 50

Are phage particles that contain only bacterial DNA characteristic of generalized or specialized transduction?

Back 50

Specialized

Front 51

Explain how generalized transducing particles are formed during lytic growth of a phage such as P1.

Back 51

*

Front 52

Explain the difference between generalized and specialized transduction.

Back 52

Specialized transduction- a transduction process in which only a specific set of bacterial or achaeal genes are carried to a recipient cell by a bacterial or archaeal genes are carried to a recipient cell by a temperate virus; the cells genes are aquired b/c of a mistake in the excision of a provirus durring the lysogenic life cycle
Generalized transduction- the transport of any part of a prokarotic genome when the DNA fragnment is packaged within a capsid by mistake

Front 53

Explain how a specialized transducing phage is formed. What is the role of lysogeny in this process?

Back 53

*