Use LEFT and RIGHT arrow keys to navigate between flashcards;
Use UP and DOWN arrow keys to flip the card;
H to show hint;
A reads text to speech;
25 Cards in this Set
- Front
- Back
What is the central dogma of molecular genetics? |
replication DNA--->RNA--->Protein |
|
What is a gene? |
A sequence of nucleotides in a DNA molecule that code for a trait; a sequence of DNA nucleotides that result in the formation of a protein. |
|
Transcription is the synthesis of _______, while translation is the synthesis of __________. |
RNA, Polypeptide |
|
The order of the ribonucleotides of what molecule determines the order of the amino acids in a protein? |
mRNA |
|
Trancription occurs in the ______ while translation occurs in the ________. |
Nucleus, ribosomes |
|
The RNA molecule produced from the DNA strand is ______ of the DNA template and is synthesized in the _________ direction. |
, 3'-5' |
|
RNA is synthesized on a DNA template in the process of _______, which untilizes the enzyme_____. |
Transcription, RNA polymerase |
|
There are specific nucleotide sequences in DNA thatrepresent the start site and the stop site for transcription. These are known, respectively, as ____ and _____
|
Promoters, Terminators |
|
What is the difference between an intron and an exon?
|
Introns are noncoding interruptions within the gene. They promote recomination and separate exons.
Exons are coding sequences, sequences that are expressed, genes |
|
What are 4 differences between prokaryotictranscription and eukaryotic transcription?
|
1.Prokaryotic genes are in operons where two or more structural genes are transcribed onto a single RNA molecule. Eukaryotic genes are transcribed separately and are under separate regulation
2. In Prokaryotes a single RNA polymerase catalyses all 3 types of RNA. In Eukaryotes there are 3 different RNA polymerases 3. Prokayotes: ribosomes attach to an mRNA molecule and begin translation even before transcription is complete. Eukaryotes: transcription and translation are separate. 4. Prokaryote: RNA is not modified before translation occurs. Eukaryote: mRNA is modified before translation occurs |
|
Eukaryotic mRNAs are often modified before they leave thenucleus. The modification includes the addition of a 5' _____ and a 3' ______.
|
"cap" nucleotide 7-methylguanine string of adenines to 3' end called poly-A tail |
|
Besides the cap and tail being added to it, what otherchange(s) does the eukaryotic mRNA undergo before it leaves the nucleus?
|
Introns are excised and then exons are spliced together.
|
|
What is a codon?
|
3 mRNA nucleotides IN SEQUENCE that code for one amino acid
|
|
What is the genetic code?
|
How the cell knows which mRNA codons code fro which amino acids
|
|
Amino acids are carried to the site of protein synthesisby ______, and they are attached to the _____ end of this molecule.
|
|
|
. Which site of a tRNA molecule bonds to themRNA molecule?
|
|
|
What are the 3 stages of protein synthesis?
|
Initiation, Elongation, Termination |
|
List the parts of the initiation complex
|
Small ribosomal unit, mRNA, initiatior tRNA
|
|
During protein synthesis, once a bond has been formedbetween the two amino acids and the ribosome moves one codon down the mRNA chain, which site isleft open to accept the incoming tRNA?
|
A site
|
|
When both the P and A site are occupied duringtranslation, what enzyme creates a bond between the amino acid in the P site and the amino acid in the Asite? |
Don't do |
|
What occurs during termination of translation?
|
1. There is a termination codon near the end of the mRNA sequence.
2. Protein called release factor binds to the remination codon in the A site, and causes the ribosome to add a water molecule instead of an amino acid to the polypeptide chain. this reaction hydrolyzes the complete polypeptide chain from the tRNA that is in the P site. 3. Polypeptide is freed and the 2 ribosomal subunits separate. |
|
Given the following DNA sequence, what would be thepolypeptide produced from protein synthesis? UseFigure 14.6 on page 222 of your book. TACGGGCCCAAATTTGCAATT
|
|
|
What is a mutation?
|
Any sequence of nucleotides in a DNA molecule that does not exactly match the original DNA molecule from which it is copied. |
|
. How can a mutation occur?
|
Errors in DNA replication or DNA repair mechanisms, and external factors including radiation and reactive chemicals, can cause random changes, such as mutations in the DNA
|
|
Name and describe 2 types of mutations thatoccur that are NOT visible in the karyotype.
|
Point mutations- mutations that involve only a single nucleotide substitution Frame-shift mutations- result from deletion or addition of nucleotides within a gene |