Genetics Ch. 10

Front 1

Recombinant DNA

Back 1

Donor DNA + vector DNA

Only one is taken up by each bacterial cell.

Front 2

Clone

Back 2

Each contains the recombinant DNA molecule.

Set of amplified copies of the single-donor DNA fragment within the cloning vector

Front 3

Restriction endonuclease

Back 3

Enzymes that cut at specific DNA sequences

Front 4

Plasmid

Back 4

Small carrier molecules that replicate their DNA independent of the bacterial chromosome

Front 5

Vector

Back 5

Plasmid or bacterial virus that will "carry" and amplify the gene of interest.

Front 6

Chimera

Back 6

.

Front 7

DNA Library

Back 7

Collection of clones that span the target DNA

Front 8

cDNA

Back 8

.

Front 9

Antibiotic resistance genes

Back 9

.

Front 10

Screening

Back 10

.

Front 11

DNA sequencing

Back 11

Sanger dideoxy sequencing.

DNA synthesis is blocked by ddNTP because it lacks the 3'-hydroxyl group

Front 12

Southern blot

Back 12

Fragments are separated on a gel, DNA is transferred from gel to membrane.

DNA on membrane is probed- pattern on membrane will reflect the bands on the gel

Front 13

Northern blot (RNA blot)

Back 13

Modified southern blot to detect a specific RNA molecule from a mixture of RNAs fractionated on a gel

Front 14

Hybridization

Back 14

Staggered cuts leave identical sticky ends that can base pair to a complementary sequence.

Single strand pairing

Probe 3’AAGCCTATTTATGGG5’

clone5’GTCTTGCTTCGGATAAATACCCGTACGGTAGTA3’

Front 15

Electrophoresis

Back 15

Separation of DNA fragments in a matrix based on size.

All DNA molecules have the same charge.

Smaller fragments will move faster.

DNA specific stains will identify DNA on the gel.

Front 16

Probe

Back 16

Screens library to find the recombinant DNA molecule containing the gene of interest.

DNA is used to find complmentary sequences, usually a cloned piece of DNA homologous to the desired sequence.

Recognize a specific nucleic acid sequence or recognize a specific protein

Front 17

Probe 1

Radioactive isotope

Back 17

Recognize a specific nucleic acid sequence.

Membrane is placed on a piece of X-ray film and the decay of the radioisotope produces subatomic particles that expose the film producing autoradiogram

Front 18

Probe 2

Fluorescent dye

Back 18

Recognize a specific nucleic acid sequence.

Membrane is exposed to the correct wavelength of light to activate the dye's fluorescence and a photograph is taken of the membrane to record the location

Front 19

Autoradiogram

Back 19

A dark spot on the film adjacent to the location of the radioisotope concentration

Front 20

Restriction mapping

Back 20

.

Front 21

PCR (Polymerase Chain Reaction)

Back 21

Amplification of a very small amount of DNA.

Amplification by DNA polymerase extracted from a heat-tolerant bacteria.

Steps: Denaturation, Primer annealing, Polymerization.

Each cycle doubles the number of DNA molecules

Front 22

DNA palindrome

Back 22

Both strands have the same nucleotide sequence but in antiparallel orientation

Front 23

pUC8 plasmid vector

Back 23

DNA inserts disrupt a gene (lacZ) in the plasmid that encodes an enzyme (B-galactosidase) necessary to cleave a compound added to the agar (X-gal) so that it produces a blue pigment.

Will produce white pigment.

Front 24

Source of DNA to make probe

Back 24

Homologous gene or a cDNA from a related organism.

OR

DNA synthesized from AA sequence

Front 25

Probe for protein

Back 25

Protein product of a gene is known and isolated in pure form to be used to detect the clone of the corresponding gene in a library

Front 26

Transgenic cells

Back 26

Cells modified by the addition of exogenous DNA.

Can introduce new or modified genetic material into eukaryotic cells

Front 27

Gene therapy

Back 27

Alleviation of genetic disease by the addition of exogenous wildtype DNA