Reading...
Play button
Play button
Use LEFT and RIGHT arrow keys to navigate between flashcards;
Use UP and DOWN arrow keys to flip the card;
H to show hint;
A reads text to speech;
42 Cards in this Set
- Front
- Back
- 3rd side (hint)
|
Which of the following amino acids would have two charged functional groups in a solution of pH 7?
A. Phenylalanine B. Leucine C. Tyrosine D. Serine E. All of the above. |
E. All of the above
|
At neutral pH, amino acids in solution exists as dipolar ions (zwitterions). The amino group is protonated (NH3+)and the carboxyl group is deprotonated (COO-).
|
|
|
Which of the following biochemical measurements can be accomplished using antibodies as specific reagents?
A. Purification of a specific protein by affinity chromatography. B. Detection of the presence of a specific protein in a biological sample. C. Identifying the location of a specific protein within a cell. D. Monitoring the abundance of a specific protein during successive steps of a protein purification procedure. E. All of the above. |
E. All of the above
|
Chpt 3
|
|
|
What pair of molecules can form a Watson-Crick base pair?
|
Guanine & Cytosine
or Adenine & Thymine (or Uracil) |
See page112 for structures
|
|
|
The reason that complementary single strands of DNA in a solution will spontaneously bind to each other to form double stranded DNA is:
A. The decreased entropy in the system that occurs when the single strands convert to a double stranded molecule is thermodynamically favorable. B. The enthalpy released from the molecules in the system when they convert to the double stranded form generates enough heat to cause an overall increase in the entropy of the universe. C. Covalent bonds are formed between the molecules that link them together in the double stranded form. D. The reaction for double stranded DNA formation has a positive value of ΔG. E. There is a negative value of ΔH for the conversion of two single stranded molecules to a double stranded molecule. |
B. The enthalpy released from the molecules in the system when they convert to the double stranded form generates enough heat to cause an overall increase in the entropy of the universe.
|
|
|
|
Which of the following types of bonds between atoms has the lowest energy?
A. van der Waals bond B. Electrostatic bond C. Hydrogen bond D. C-C single bond E. C=C double bond |
A. van der Waals bond
|
Bond Energies
=>-->H+>ES>van der Waals |
|
|
An acid/base buffer contains H2PO4- (the acid) and HPO42- (the base) mixed together at a ratio of 10:1. What is the pH of the buffer?
A. 6.21 B. 7.21 C. 8.21 D. 6 E. 10 |
A. 6.21
|
[A-] / [HA] = 10X(pH - pka)
|
|
|
Which of the following cloning vectors would be most useful for cloning a DNA fragment of 100 kilobase pairs in length?
A. A pBR322-type vector. B. A pUC18-type vector. C. A phage λ vector. D. A bacterial artificial chromosome vector. E. None, a fragment of that size cannot be cloned. |
D. A bacterial artificial chromosome vector.
|
|
|
|
Which of the following explains why protein folding is a cooperative process?
A. The hydrophobic effect locks each nonpolar side chain into a specific location in the folded structure. B. Local areas of partially folded structure stabilize each other, so folding proceeds at an increasingly faster rate as it progresses. C. New proteins fold by interacting with existing template proteins that dictate their structures. D. Once disulfide bonds form the rest of the polypeptide folds rapidly into its final conformation. |
B. Local areas of partially folded structure stabilize each other, so folding proceeds at an increasingly faster rate as it progresses.
|
|
|
|
Which of the following is the most important factor explaining why double stranded nucleic acids adopt a helical shape?
A. Hydrogen bonds between the bases stacked on top of each other draws them closer together. B. Bringing the hydrophobic bases close together excludes water, favoring the hydrophobic effect. C. The helical form causes maximum separation of the charged phosphate groups in the backbone. D. Covalent bonds between the bases lock the structure into a helical conformation. E. Watson-Crick base pairing can only occur when the polymers are in a helical conformation. |
B. Bringing the hydrophobic bases close together excludes water, favoring the hydrophobic effect.
|
|
|
|
Which of the following molecules would be included in a controlled termination reaction to identify "A" residues in a DNA sequence?
|
2', 3' Didexoy analog
|
Chpt 5
|
|
|
Which of the following statements about paralogous proteins is TRUE?
A. They have distinct three-dimensional structures. B. They have unrelated amino acid sequences. C. They arise from gene duplication in a single species. D. None of the choices listed here are true. E. They exist in two or more different species. |
C. They arise from gene duplication in a single species.
|
|
|
|
Which of the following is THE FIRST STEP of the process of cloning of a gene based on amino acid sequence information obtained from a purified protein?
A. Designing an oligonucleotide probe sequence that could code for the known amino acid sequence. B. Infecting E. coli cells with a recombinant phage λ virus population. C. Forming a double stranded DNA molecule between the labeled oligonucleotide probe and the genomic DNA in a specific phage λ clone. D. Constructing a library of genomic DNA fragments in a phage λ cloning vector. E. Labeling the 5' end of the oligonucleotide probe with 32P. |
A. Designing an oligonucleotide probe sequence that could code for the known amino acid sequence.
|
|
|
|
Which of the following amino acid sequences would be produced from an eukaryotic mRNA that begins with the following sequence?
5'ACGUUCUGAGCCAGGAUUUUAGGGCCCUAC3' A. Thr-Phe-Met-Tyr-Ala-His-Phe B. None, because there is no Shine-Delgarno sequence present. C. Met-Pro-Gly-Phe D. Met-Pro-Gly-Phe-Gly-Pro-Tyr E. Thr-Phe |
C. Met-Pro-Gly-Phe
|
Sequence starts at first AUG condon.
|
|
|
Which of the following is the most accurate way to identify homologous proteins?
A. Structural similarity. B. RNA sequence similarity. C. DNA sequence similarity. D. Similar functional mechanisms. E. Amino acid sequence similarity. |
A. Structural similarity.
|
|
|
|
The human genome contains about 3,000,000,000 base pairs. Assuming an average protein includes about 1000 amino acids, how many proteins could possibly be encoded in the human genome?
A. 10,000 B. Can't be determined from the given information. C. 1,000 D. 100,000 E. 1,000,000 |
E. 1,000,000
|
|
|
|
Approximately how many proteins are encoded in the human genome?
A. 100,000 B. 25,000 C. 10,000 D. 1,000 E. 1,000,000 |
B. 25,000
|
|
|
|
What happens to nonpolar molecules that are mixed with water?
A. They form hydrogen bonds with each other. B. They disperse in the solution by forming hydrogen bonds with water molecules. C. They precipitate from solution. D. They aggregate with each other so as to minimize their interactions with water molecules |
D. They aggregate with each other so as to minimize their interactions with water molecules.
|
|
|
|
Imagine an alternate biological system in which amino acids contain a methyl group attached to the α carbon instead of the proton that occurs in amino acids on Earth, as shown in the figure. How do proteins in the imaginary world compare to those on Earth?
A. They have more possible secondary and tertiary structures than our proteins. B. They fold more rapidly than our proteins. C. They have fewer possible secondary and tertiary structures than our proteins. D. They are more stable than our proteins. E. They are less stable than our proteins. |
C. They have fewer possible secondary and tertiary structures than our proteins.
|
|
|
|
Which of the following is a possible benefit of alternating coding and non-coding regions in eukaryotic genes?
A. Discrete functional units of protein folding and structure can be exchanged by DNA recombination. B. Differential splicing can generate multiple proteins from a single gene. C. Structural features within introns can regulate DNA polymerase activity. D. Both a and b E. Both a and c |
D. Both a and b
|
|
|
|
In a molecular evolution experiment that identified improved RNA binding to a specific ligand, what feature of the molecule is most likely to have changed?
A. The nucleotide sequence. B. The size of the RNA molecule in bases. C. The frequency of adenosine residues. D. The percentage of the molecule that is single stranded. E. The number of modified bases. |
A. The nucleotide sequence.
|
|
|
|
Which of the following is a reason that NMR spectroscopy is advantageous over X-ray crystallography as a means of determining protein structure?
A. NMR spectroscopy can analyze larger proteins than X-ray crystallography. B. NMR spectroscopy is more rapid than X-ray crystallography. C. None of the above, X-ray crystallography is always a better method than NMR spectroscopy. D. NMR spectroscopy requires substantially less protein than X-ray crystallography. E. NMR spectroscopy reveals the range of motions that are possible in a particular protein, whereas X-ray crystallography reveals only one possible conformation. |
E. NMR spectroscopy reveals the range of motions that are possible in a particular protein, whereas X-ray crystallography reveals only one possible conformation.
|
|
|
|
Which of the following information is provided by the technique of microarray hybridization?
A. The quantity of protein in an organism. B. The quantity of RNA in an organism. C. The quantity of DNA in an organism. D. The relative steady-state level of protein produced from essentially all of the genes present in the genome of an organism. E. The relative steady-state level of mRNA produced from essentially all of the genes present in the genome of an organism. |
E. The relative steady-state level of mRNA produced from essentially all of the genes present in the genome of an organism.
|
|
|
|
Which of the following statements about DNA polymerase is FALSE?
A. DNA polymerase requires a primer molecule with a free 3' hydroxyl group in order to be active. B. DNA polymerase requires a template strand in order to be active. C. DNA polymerase grows the new chain only in the 5' → 3' direction. D. DNA polymerase activity releases inorganic phosphate (Pi) as a product. E. DNA polymerase utilizes TTP nucleotides and does not use UTP nucleotides . |
D. DNA polymerase activity releases inorganic phosphate (Pi) as a product.
|
|
|
|
From the figure shown below, which molecule is not normally found as part of a deoxyribonucleotide?
A. B. C. D. |
A
|
|
|
|
Which of the following amino acids is most likely to be part of a peptide bond that exists in the cis configuration?
A. Glycine B. Tryptophan C. Alanine D. Proline E. Histidine |
D. Proline
|
|
|
|
Which of the following best describes two proteins that have different three-dimensional structures but use the same chemical mechanism to catalyze a reaction?
A. They are paralogs. B. They arose on different planets. C. They evolved from a common ancestor. D. They are homologs. E. They evolved independently. |
E. They evolved independently.
|
|
|
|
Match the protein purification technique in the right column to the numbered molecular basis of the separation noted in the left column.
1. Molecular size of native protein (hydrodynamic volume) 2. Molecular mass of each subunit in a protein 3. Ability to bind to a specific ligand 4. Net charge of a native protein 5. Molecular mass of native protein A. Ion-exchange chromatography B. Affinity chromatography C. SDS-polyacrylamide gel electrophoresis D. sedimention equilibrium centrifugation E. Gel-filtration chromatography |
Molecular size & Gel-filtration chromatography
Molecular Mass & SDS-polyacrylamide gel electrophoresis Binding to a specific ligand & Affinity chromatography 4. Net charge & Ion-exchange chromatography 5. Molecular mass & sedimention equilibrium centrifugation |
|
|
|
An enzyme with molecular weight of 25,000 Da and pI of 5.5 is contaminated with another protein of 165,000 Da and pI of 5.6. Based on these characteristics, which of the following techniques would be the most effective at separating these two proteins.
A. NMR spectroscopy B. Size exclusion chromatography C. Ion exchange chromatography D. Affinity chromatography E. ELISA assay |
B. Size exclusion chromatography
|
|
|
|
Which of the following describes a similarity between α-helices and β-sheets?
A. Both are stabilized by H bonds between two different polypeptide chains. B. Both are stabilized by H-bonding between amide protons and carboxyl oxygens of the main chain. C. Both have similar phi/psi angle combinations. D. Both leave only hydrophilic R groups exposed on the exterior of the secondary structure element. E. All of the above. |
B. Both are stabilized by H-bonding between amide protons and carboxyl oxygens of the main chain.
|
|
|
|
Which of the following types of molecular interactions can be important in determining the tertiary structure of a protein?
A. Hydrogen bonds B. Covalent bonds C. Electrostatic bonds D. Hydrophobic effects E. All of the above |
E. All of the above
|
|
|
|
Two-dimensional electrophoresis can separate approximately 1000 proteins from a given biological source into distinct spots. The methods routinely used to identify the protein in most of those spots are:
A. Mass spectrometry to identify peptide fragment masses or amino acid sequences, and genomic DNA sequencing to identify the entire protein. B. None of these answers is correct, it is not possible to identify proteins in two-dimensional gel spots. C. Ion-exchange chromatography to identify the net charge on the protein and gel permeation chromatography to identify its size and approximate mass. D. X-ray crystallography E. Identification by binding to specific antibodies. |
A. Mass spectrometry to identify peptide fragment masses or amino acid sequences, and genomic DNA sequencing to identify the entire protein.
|
|
|
|
Two-dimensional electrophoresis can separate approximately 1000 proteins from a given biological source into distinct spots. The methods routinely used to identify the protein in most of those spots are:
A. Mass spectrometry to identify peptide fragment masses or amino acid sequences, and genomic DNA sequencing to identify the entire protein. A. The target nucleotide sequences are not present in the host cdll DNA. B. The host maintains a low concentration of Mg2+ ions, which are necessary for restriction endonuclease function. C. The host cell contains methyl transferase enzymes that modify the target DNA sequences so that the restriction enzyme cannot bind. D. The region of host cell DNA containing the target sequences is separated into a single strands. E. All of the mechanisms listed here can be utilized by the host cell. |
C. The host cell contains methyl transferase enzymes that modify the target DNA sequences so that the restriction enzyme cannot bind.
|
|
|
|
Which of the following amino acids is most likely to be found in the interior of a globular protein?
A. Serine B. Valine C. Glutamate D. Lysine E. Aspartate |
B. Valine
|
|
|
|
Choose the answer that best completes the following statement: The pKa of an acid reveals _____.
A. the pH of the solution. B. the pH at which the acid will have no charge. C. the amount of base that can be added to the solution without changing the pH. D. the pH at which half of the acidic groups will be in the protonated form and half in the dissociated form. |
D. the pH at which half of the acidic groups will be in the protonated form and half in the dissociated form.
|
|
|
|
Is the following statement true or false?
Proteins with 20% amino acid sequence identity could have the same three-dimensional structure. |
TRUE
|
Sequence Identity 25% or greater indicates that proteins likely share common folds. SI of 15% or less are less likely to be homologous.
|
|
|
List the steps required for production of a functional mRNA molecule in a eukaryotic cell, beginning with the gene.
|
1) Binding of RNA polymerase to the DNA at a specific site near the beginning of the gene. 2) Transcription by RNA polymerase to produce a primary transcript (pre-mRNA). For this the four ribonculeotide triphosphates and Mg++ 3) Addition of the "CAP" chemical modification at the 5' end of the transcript and addition of extra A residues to the 3' end, i.e., the polyA tail 4) Splicing to remove intron sequences
|
|
|
|
Briefly describe the reason that bond rotation in a polypeptide chain can occur around bonds involving the alpha carbon, but not around the peptide bond.
|
The covalent bond between the carboxyl group and the amino group has increased double bond character due to the resonance of the double bond of the adjacent carboxyl. This makes the peptide bond planar and reduces bond rotation. In contrast the the bonds between the amino group and the alpha carbon, and the bonds between the alpha carbon and the carbonyl group are pure single bonds. This freedom of rotation is what allows proteins to fold in various configurations.
|
|
|
|
Two-dimensional electrophoresis can separate approximately 1000 proteins from a given biological source into distinct spots. The methods routinely used to identify the protein in most of those spots are:
A. Mass spectrometry to identify peptide fragment masses or amino acid sequences, and genomic DNA sequencing to identify the entire protein. B. None of these answers is correct, it is not possible to identify proteins in two-dimensional gel spots. C. Ion-exchange chromatography to identify the net charge on the protein and gel permeation chromatography to identify its size and approximate mass. D. X-ray crystallography E. Identification by binding to specific antibodies. |
A. Mass spectrometry to identify peptide fragment masses or amino acid sequences, and genomic DNA sequencing to identify the entire protein.
|
|
|
|
A. Mass spectrometry to identify peptide fragment masses or amino acid sequences, and genomic DNA sequencing to identify the entire protein.
A. The target nucleotide sequences are not present in the host cdll DNA. B. The host maintains a low concentration of Mg2+ ions, which are necessary for restriction endonuclease function. C. The host cell contains methyl transferase enzymes that modify the target DNA sequences so that the restriction enzyme cannot bind. D. The region of host cell DNA containing the target sequences is separated into a single strands. E. All of the mechanisms listed here can be utilized by the host cell. |
C. The host cell contains methyl transferase enzymes that modify the target DNA sequences so that the restriction enzyme cannot bind.
|
|
|
|
Which of the following amino acids is most likely to be found in the interior of a globular protein?
A. Serine B. Valine C. Glutamate D. Lysine E. Aspartate |
B. Valine
|
|
|
|
Choose the answer that best completes the following statement: The pKa of an acid reveals _____.
A. the pH of the solution. B. the pH at which the acid will have no charge. C. the amount of base that can be added to the solution without changing the pH. D. the pH at which half of the acidic groups will be in the protonated form and half in the dissociated form. |
D. the pH at which half of the acidic groups will be in the protonated form and half in the dissociated form.
|
|
|
|
Is the following statement true or false?
Proteins with 20% amino acid sequence identity could have the same three-dimensional structure. |
TRUE
|
|
