Test Tomorrow

Front 1

What is Recombinant DNA

Back 1

The combining of DNA from 2 different species/organisms using Restriction Enzymes

Front 2

What is the procedure of Recombinant DNA?

Back 2

1. Remove the DNA from the Host
2. Use specific Ristriction Enzymes to cut out the original gene from the host DNA.

-Leaves "StickyEnds*

Front 3

The sequence of DNA that the enzyme recongnizes is called the...?

Back 3

Recognition Site

Front 4

Fliter out the old gene so that only the "... ......" remain.

Back 4

end pieces..

Front 5

Use the ____ restriction enzyme to "cut" out the new gene that will be _______

Back 5

- same
- inserted

Front 6

by using the same enzyme, we'll have the same ___________

Back 6

-Sticky Ends

Front 7

Mix the ___ ____ ____ with the ____ ____

Back 7

-old host DNA
-new gene

Front 8

Insert the NEW __________ ___ back into the host

Back 8

-Recombinant DNA

Front 9

Last step: Host cell will now make the (_______) the gene codes for!

Back 9

protein :-)

Front 10

what's the sequence for
AACAATTAGCGGTCAATTACGGGTCACAATTCG

Back 10

UUGUUAAUCGCCAGUUAAUGCCCUGUGUUAAGC

Front 11

What is a cutting site?

Back 11

A specific nucleotide sequence of DNA at which a particular restriction enzyme cuts the DNA

Front 12

How does a PROBE stick to the DNA?

Back 12

It sticks to the DNA when you have a special order of bases you're looking at.

EX: G T C A
C A G T

Front 13

Where do the largest pieces of DNA end up on the gel?

Back 13

Near the Top

Front 14

Where do the smalled pieces of DNA end up on the gel?

Back 14

Near the bottom

Front 15

If there was a rapist how would bands tell you who it was?

Back 15

The DNA sperm sample found in the rape victum should be an exact match as the one found on the suspect

Front 16

Restriction Enzymes: do what?

Back 16

Cut a specifec DNA sequence

Front 17

Radioactive Probes:

Back 17

Small DNA sequence that's radioactive and will stick to a complementary sequence + GLOW

Front 18

what does PCR: do

hnt: Xerox Machine

Back 18

Makes billions of copies of DNA sequence

--> like a xerox machine

Front 19

What does a Gel Electrophoresis do?

Back 19

Techinique that seperated DNA fragments by size

Front 20

(what size molecules) move farther down the gel than (what size molecules)

Back 20

-Small
-Large

Front 21

What's the DNA sequencing technique?

Back 21

Finds the exact base sequence of a gene

Front 22

Cut gene out of the DNA with

Back 22

-Restriction enzymes

Front 23

Copy gene with ***

Back 23

PCR

Front 24

Make gene radioactive so we can see what?

Back 24

-See it glow

Front 25

You read a DNA sequence from ____ to __

Back 25

bottom to top

Front 26

Read this sequence:

A T C G
-
-
-
-
-

Back 26

G C A T A

Front 27

DNA profiling:

1. Know as DNA ___________
2. Based on the idea that
no two people will....except for...
3. uses
-Identification
-Show

Back 27

1. fingerprinting
2. no two people will have the same DNA code except for identical twins
3. -indefication of DNA by comparison
-Show genetic relationship

Front 28

Procedure: (of DNA profiling)
1. DNA is extracted from what?
2. DNA is cut using ____ to unwind and unzip the DNA, and using a _________ to cut the strand into pieces
3. a. single-stranded radioactive ____ is made.
b. ____ makes copies of the probe
c. DNA from cells is ____ with the
probe
d. Bases on probe are ________ to
certain bases on DNA
e. Fragments with probes are now
________ and can be seen on a gel.
4. The DNA is run on a ___

Back 28

1. bloode cells, skin cells, semen
2. heat, restriction enzymes
3. a.probe b.PCR c.treated d.complimentary e.radioactive
4. gel

Front 29

Results of various cells are compared using a ______ which has a fragment at every size and will tell us if the gel is working properly. By comparing to the _____, we can also determind the size of fragment run on the same gel.

Back 29

Standard
Standard

Front 30

In a criminal case you look for an _____________ with DNA from sample left at crime scene.

Back 30

an exact match

Front 31

Paternity Case: looking for half the bands to match the _____ and half the bands to match _____since each parent contributes to the child's genetic makeup

Back 31

-Mother
-Father

Front 32

Haploid-

Back 32

Having the same number of sets of chromosomes as a germ cell or half as many a somatic cell.

Front 33

Diploid-

Back 33

Having a pair of each type of chromosome, so that the basic chromosome is doubled: Diploid somatic cells.

Front 34

Polypoidy

Back 34

Means the strawberries have an extra set of chromosomes

Front 35

Mutations-

Back 35

Changes in the bases of the DNA molecule

Front 36

Mutations affect the what?

Back 36

genetic information

Front 37

Mutations can change the proteins made by a cell or

Back 37

prevent a protein from being made at all.

Front 38

Point Mutations:

Affects ________
Usually called a _________

May or may not affect the protein being made

Back 38

one nucelotide
substitution

Front 39

Frame Shift Mutations
(Inserting or Deleting a nucleotide)
Insertion-
Deletion-

These shift the reading fram of the DNA
__________________________________

(remember DNA is read in groups of 3!)

Back 39

Insertion- adding a nucleotide
Deletion- deleting a nucleotide

and can cause drastically different results

Front 40

Change over time

DNA mutations may _______________

This trait is then ___________________________________________________

Overtime mutation can________________________________________________________

Sickle-Cell anemia is an example of this

Back 40

-individual new trait
-passed onto that individuals offspring
-become part of the population

Front 41

Adaptations

Not all mutations are harmful, infact sometimes the can....

And adaptation is something that increases the chance

Back 41

-They can result in adaptation
-that the individual will survive to produce offspring

Front 42

What four bases are present in DNA

Back 42

adenine, guanine, thymine, cytosine

Front 43

What four bases are present in RNA

Back 43

Adenine, guanine, uracil, cytosine

Front 44

Difference between codon and an anticodon

Back 44

codons are balanced groups of mRNA. Anticodons on tRNA

Front 45

What carries each amino acid to the ribosome to be asembled into a protein

Back 45

tRNA molecule

Front 46

What is the making of mRNA from DNA called?

Back 46

Transcription

Front 47

Where in the cell does this process occur?

Back 47

The nucleus

Front 48

What is the making of a sequence of amino acids from a sequence of RNA nucleotides called?

Back 48

translation

Front 49

Where in the cell does translation occur

Back 49

The Cytoplasm

Front 50

The molecule which carries the genetic code from the nucleus to the cytoplasm for interpretation is

Back 50

mRNA

Front 51

A short sequence of DNA which carries the instructions to make one specific protein is called a

Back 51

gene

Front 52

Change in a genetic code is called

Back 52

Mutation

Front 53

if DNA is like a ladder which two molecules of a nucleotide are found on the sides of the ladder?

Back 53

The Sugar and the Phosphate

Front 54

To which molecule does each base attach?

Back 54

Sugar

Front 55

What pairs with what?
Cytosine, guanine, thymine,adenine

Back 55

C=G
T=A

Front 56

What is DNA made of?

Back 56

Nucleotides

Front 57

What are the three parts of a nucleotide

Back 57

bases, phosphate, sugar

Front 58

how do nucleotides differ from each other

Back 58

RNA uses uracil and not thymine

Front 59

after DNA replication --% of the new DNA strand is made up of the old original DNA

Back 59

50%

Front 60

whats the first step of DNA replication

Back 60

unwinding of the double helix

Front 61

what is the second step of DNA replication

Back 61

DNA strands seperate, bases are exposed. Synthesis will be begin

Front 62

What is the third step of DNA replication

Back 62

Termination

Front 63

what is DNA replication

Back 63

before a cell divides, it needs to make 2 copies of it's DNA. This process is called DNA replication

Front 64

DNA replication..
1. 'u....' and 'u...'

Back 64

undwind and unzip

Front 65

5-carbon sugar found in DNA is called ------- while the sugar in RNA is called -------

Back 65

deoxyribose, ribose

Front 66

DNA is where?

Back 66

The nucleus

Front 67

DNA contains information about

Back 67

Traits/Heredity

Front 68

Change in the sequence of DNA changes what?

Back 68

The Protein

Front 69

Whats a Gene-?

Back 69

section of DNA that codes for a protein

Front 70

DNA is made of

Back 70

Nucleotides

Front 71

DNA is like a what?

Back 71

ladder

Front 72

DNA is like a twisted ladder called a
------- -------
Sides of the lader are
----- ----- ----------
Rungs of the ladder are
--------

Back 72

Double Helix
Sugar and Phosphate
bases

Front 73

The order of bases determines the

Back 73

Protein

Front 74

Changing the order of bases changes the what?

Back 74

Protein

Front 75

Any unintentional change in the order of bases is called a

Back 75

Mutation

Front 76

Subunits that make up nucelic acids are

Back 76

DNA and RNA

Front 77

The nitrogenous base that is found in RNA but not in DNA is

Back 77

Uracil

Front 78

The DNA molecule has how many strands?

Back 78

2

Front 79

Each strand of DNA is a long chain of ______ units

Back 79

nucleotide

Front 80

Strands of DNA are held together by hydrogen bonds between the

Back 80

nitrogenous bases

Front 81

Why can DNA never leave the nucleus

Back 81

It's to big

Front 82

the m in mRNA stands for what?

Back 82

messenger

Front 83

Where are these mRNA nucelotides coming from?

Back 83

the cytoplasm

Front 84

RNA is (what stranded)

Back 84

Single-Stranded

Front 85

the mRNA leaves the nucleus (Unlike the DNA) because

Back 85

one stranded

Front 86

the job of the ribosome is to

Back 86

make proteins

Front 87

the t in tRNA stands for

Back 87

transfer