Study your flashcards anywhere!

Download the official Cram app for free >

  • Shuffle
    Toggle On
    Toggle Off
  • Alphabetize
    Toggle On
    Toggle Off
  • Front First
    Toggle On
    Toggle Off
  • Both Sides
    Toggle On
    Toggle Off
  • Read
    Toggle On
    Toggle Off
Reading...
Front

How to study your flashcards.

Right/Left arrow keys: Navigate between flashcards.right arrow keyleft arrow key

Up/Down arrow keys: Flip the card between the front and back.down keyup key

H key: Show hint (3rd side).h key

A key: Read text to speech.a key

image

Play button

image

Play button

image

Progress

1/33

Click to flip

33 Cards in this Set

  • Front
  • Back
1. Predict the amino acid sequence to the following mRNA sequences.
ANSWER Assuming that the reading frame begins with the first three bases in each sequence:
a. GGUCAGUCGCUCCUGAUU
b. UUGGAUGCGCCAUAAUUUGCU
c. CAUGAUGCCUGUUGCUAC
d. AUGGACGAA
2. Write all possible mRNA sequences that can code for Leu-Met-Tyr.
ANSWER The genetic code is degenerate, meaning that a given amino acid may be specified by
more than one codon. Leu is specified by six different codons: UUA, UUG, CUU, CUC, CUA, CUG. Met, when not used as an initiation codon, is specified by AUG; Tyr is specified by two codons: UAC, UAU. Thus, 6 x 1 x 2 = 12 possible rnRNA sequences can code for a tripeptide segment Leu-Met-Tyr:
3. A given mRNA codes for one and only one polypeptide. From a given a.a. sequence, then, can one predict the base sequence of the unique mRNA that codes for it?
ANSWER No. Because nearly every amino acid has more than one codon, any given polypeptide can be coded for by a number of different base sequences. However, because some amino acids are encoded by only one codon and those with multiple codons often share the same nucleotide at two of the three positions, certain parts of the mRNA sequence encoding a protein of known amino acid sequence can be predicted with high certainty.
4. A DNA has the sequence
ANSWER The template strand serves as the template for RNA synthesis; the nontemplate
a. What is the base sequence of the mRNA transcribed
strand is identical in sequence to the RNA transcribed from the gene, with U in place of T.
b. What a.a. sequence could be coded by this mRNA
(a) (5')CGAACGGCGCGAAGUCAGGGGUGUUAAG(3')
c. If the complementary strands of the DNA were transcribed & translated, would the resulting polypeptide be the same?
(b) Arg-Thr-Ala-Arg-Ser-Gln-Gly-Cys-Stop
(c) No. The base sequence of mRNA transcribed from the nontemplate strand would be
(5')CUUAACACCCCUGACUUCGCGCCGUUCG. This mRNA, when translated, would result
in a different peptide from. The complementary antiparallel strands in double-helical DNA do not have
the same base sequence in the 5' → 3' direction. RNA is transcribed from only one specific strand of
duplex DNA. The RNA polymerase must therefore recognize and bind to the correct strand.
5. Met has only one codon. How does this one codon specify both initiating and interior Met?
ANSWER There are two tRNAs for methionine: tRNAfMet,which is the initiating tRNA, and tRNAMet,which can insert a Met residue in interior positions in a polypeptide. The tRNAfMet reacts with methionine to yield Met-tRNAfMet,promoted by methionine aminoacyl-tRNA synthetase. The amino group of its Met residue is then formylated by N10-formyltetrahydrofolate to yield fMet-tRNAfMet. Free methionine or Met-tRNAMet cannot be formylated. Only fMet-tRNAfMet is recognized by the initiation factor IF-2 and is aligned with the initiating AUG positioned at the ribosomal P site in the initiation complex. AUG codons in the interior of the mRNA are eventually positioned at the ribosomal A site and can bind and incorporate only Met-tRNAMet.
7. Sickle cell hgb has a Val instead of the Glu in normal hgb. Predict the change that took place in the DNA codon to account for this replacement.
ANSWER The two DNA codons for Glu are GAA and GAG, and the four DNA codons for Val are GTT, GTC, GTA, and GTG. A single base change in GAA to form GTA or in GAG to form GTG could account for the Glu→Val replacement in sickle-cell hemoglobin. Much less likely are two-base changes from GAA to GTG, GTT, or GTC; or from GAG to GTA,GTT, or GTC.
8. Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for Ala fall into this category. The only nucleotides of tRNAAla required for recognition by Ala-tRNA synthetase are those of the G3-U70 base pair in the amino acid arm. What would be the consequences of a C → G mutation in the 3rd position of the anticodon of tRNA Ala?
ANSWER Since the only nucleotides of tRNAAla required for recognition by Ala-tRNA synthetase are
those of the G3-U70 base pair in the amino acid arm, mutations in the anticodon region would produce a tRNAAla capable of recognizing and binding to codons for amino acids other than Ala. However, changes in the anticodon of tRNAAla would not affect the specificity of the charging reaction by Ala-tRNA synthetase.
There are four Ala codons, GCU, GCC, GCA, and GCG. The third position of each tRNAAla should be a C because this position interacts with the fIrst position of the Ala codons, which is a G in all four. Thus, changing the C in the third position of tRNAAla to a G would allow the mutant tRNAAla to recognize CCU, CCC, CCA, and CCG, all of which specify Pro. Ala residues would be inserted at sites coding for Pro.