Cell Final 3

Front 1

1. Predict the amino acid sequence to the following mRNA sequences.

Back 1

ANSWER Assuming that the reading frame begins with the first three bases in each sequence:

Front 2

a. GGUCAGUCGCUCCUGAUU

Front 3

b. UUGGAUGCGCCAUAAUUUGCU

Front 4

c. CAUGAUGCCUGUUGCUAC

Front 5

d. AUGGACGAA

Front 6

2. Write all possible mRNA sequences that can code for Leu-Met-Tyr.

Back 6

ANSWER The genetic code is degenerate, meaning that a given amino acid may be specified by

Back 7

more than one codon. Leu is specified by six different codons: UUA, UUG, CUU, CUC, CUA, CUG. Met, when not used as an initiation codon, is specified by AUG; Tyr is specified by two codons: UAC, UAU. Thus, 6 x 1 x 2 = 12 possible rnRNA sequences can code for a tripeptide segment Leu-Met-Tyr:

Front 11

3. A given mRNA codes for one and only one polypeptide. From a given a.a. sequence, then, can one predict the base sequence of the unique mRNA that codes for it?

Back 11

ANSWER No. Because nearly every amino acid has more than one codon, any given polypeptide can be coded for by a number of different base sequences. However, because some amino acids are encoded by only one codon and those with multiple codons often share the same nucleotide at two of the three positions, certain parts of the mRNA sequence encoding a protein of known amino acid sequence can be predicted with high certainty.

Front 14

4. A DNA has the sequence

Back 14

ANSWER The template strand serves as the template for RNA synthesis; the nontemplate

Front 15

a. What is the base sequence of the mRNA transcribed

Back 15

strand is identical in sequence to the RNA transcribed from the gene, with U in place of T.

Front 16

b. What a.a. sequence could be coded by this mRNA

Back 16

(a) (5')CGAACGGCGCGAAGUCAGGGGUGUUAAG(3')

Front 17

c. If the complementary strands of the DNA were transcribed & translated, would the resulting polypeptide be the same?

Back 17

(b) Arg-Thr-Ala-Arg-Ser-Gln-Gly-Cys-Stop

Back 18

(c) No. The base sequence of mRNA transcribed from the nontemplate strand would be

Back 19

(5')CUUAACACCCCUGACUUCGCGCCGUUCG. This mRNA, when translated, would result

Back 20

in a different peptide from. The complementary antiparallel strands in double-helical DNA do not have

Back 21

the same base sequence in the 5' → 3' direction. RNA is transcribed from only one specific strand of

Back 22

duplex DNA. The RNA polymerase must therefore recognize and bind to the correct strand.

Front 23

5. Met has only one codon. How does this one codon specify both initiating and interior Met?

Back 23

ANSWER There are two tRNAs for methionine: tRNAfMet,which is the initiating tRNA, and tRNAMet,which can insert a Met residue in interior positions in a polypeptide. The tRNAfMet reacts with methionine to yield Met-tRNAfMet,promoted by methionine aminoacyl-tRNA synthetase. The amino group of its Met residue is then formylated by N10-formyltetrahydrofolate to yield fMet-tRNAfMet. Free methionine or Met-tRNAMet cannot be formylated. Only fMet-tRNAfMet is recognized by the initiation factor IF-2 and is aligned with the initiating AUG positioned at the ribosomal P site in the initiation complex. AUG codons in the interior of the mRNA are eventually positioned at the ribosomal A site and can bind and incorporate only Met-tRNAMet.

Front 27

7. Sickle cell hgb has a Val instead of the Glu in normal hgb. Predict the change that took place in the DNA codon to account for this replacement.

Back 27

ANSWER The two DNA codons for Glu are GAA and GAG, and the four DNA codons for Val are GTT, GTC, GTA, and GTG. A single base change in GAA to form GTA or in GAG to form GTG could account for the Glu→Val replacement in sickle-cell hemoglobin. Much less likely are two-base changes from GAA to GTG, GTT, or GTC; or from GAG to GTA,GTT, or GTC.

Front 30

8. Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for Ala fall into this category. The only nucleotides of tRNAAla required for recognition by Ala-tRNA synthetase are those of the G3-U70 base pair in the amino acid arm. What would be the consequences of a C → G mutation in the 3rd position of the anticodon of tRNA Ala?

Back 30

ANSWER Since the only nucleotides of tRNAAla required for recognition by Ala-tRNA synthetase are

Back 31

those of the G3-U70 base pair in the amino acid arm, mutations in the anticodon region would produce a tRNAAla capable of recognizing and binding to codons for amino acids other than Ala. However, changes in the anticodon of tRNAAla would not affect the specificity of the charging reaction by Ala-tRNA synthetase.

Back 32

There are four Ala codons, GCU, GCC, GCA, and GCG. The third position of each tRNAAla should be a C because this position interacts with the fIrst position of the Ala codons, which is a G in all four. Thus, changing the C in the third position of tRNAAla to a G would allow the mutant tRNAAla to recognize CCU, CCC, CCA, and CCG, all of which specify Pro. Ala residues would be inserted at sites coding for Pro.