Study your flashcards anywhere!

Download the official Cram app for free >

  • Shuffle
    Toggle On
    Toggle Off
  • Alphabetize
    Toggle On
    Toggle Off
  • Front First
    Toggle On
    Toggle Off
  • Both Sides
    Toggle On
    Toggle Off
  • Read
    Toggle On
    Toggle Off
Reading...
Front

How to study your flashcards.

Right/Left arrow keys: Navigate between flashcards.right arrow keyleft arrow key

Up/Down arrow keys: Flip the card between the front and back.down keyup key

H key: Show hint (3rd side).h key

A key: Read text to speech.a key

image

Play button

image

Play button

image

Progress

1/56

Click to flip

56 Cards in this Set

  • Front
  • Back
process in which mRNA is used to make protein
translation
ex// of sex linked conditions
red/ green colorblindness; Duchenne muscuar clystophy
What a tetrad?
structure consisting of 4 chromatids resulting from synapsis.
anti-codon
on a tRNA molecule, a specific sequence of 3 nucleotides thats complementray to a codon triplet on mRNA
sex-linked traits
gene located on a sex chromosome
nucleotide
an organic monomer consisting of a 5 carbon sugar covalently bonded to a nitrogenous base and a phosphate group. Nucleotides are the building blocks of nucleic acids.
codon
3 nucleotide sequence in mRNA that specifies a particular amino acid or polypeptide termination signal. Basic unit of genetic code.
linked genes
genes located on the same chromosome that tend to be inherited together
what codes 4 an amino acid?
codon
transcription
occurs in the nucleus. making of RNA on a DNA template
path of blood flow in humans
begins in pulmonary (LUNG) circuit.
1) right ventricle
2) pulmonary arteries
3) capillaries
4)pulmonary veins
5) left atrium
6)left ventricle
7) aorta
8) head, chest, arms, 2 legs
9) superior vena cava and interior vena cava
10) right atrium
translation
happens i teh cytoplasm. is the making of a polypeptide using the genetic info. encoded in an mRNA. Theres change of "language" from nucleotides to amino acids
know how to match a complimentary DNA strand.

ATGCATGCTTAGTAGCTAGCATG
ATGCATGCTTAGTAGCTAGCATG=
TACGTACGAATCATCGATCGTAC
place of implantation of embryo
?
The role of tRNA
functions as an interpreter. Each tRNA molecule has a specific amino acid and conveys the amino acid to the appropiate codon of mRNA.
RNA? what does it contain? and what does it do?
a type of nucleic acid consisting of nucleotide monomers w/ a ribose sugar, nitrogenous bases, AUC&G. Usually single stranded, function in protein synthesis and as the genes of some viruses.
path of human fertilization
?
DNA? whats in it?
genetic material that organisms inherit from their parents. Double strnaded helical macromolecule consisting of nucleotide monomers with deoxyribose sugar and nitrogenous bases ATC&G.
where does replication take place?
nucleus
testes
produce sprem. in male reproduction system.
comparison of respiration of a grasshopper and earthworm
the earhtworm takes place on outer skin layer and oxygen diffuses into thin cappilaries. Grasshopper- tracheal system which requires less energy than the earhtworm and consists of a bunch of airtubes
insect excretory organs
the insects excrte uraicke acid and urakite acid is non toxic but insoluable in water and is excreted as semi solid paste
process in which mRNA is used to make protein
translation
genes that control blood type
OAB or AB and is amde form 3 diff. alleles
ex// of sex linked conditions
red/ green colorblindness; Duchenne muscuar clystophy
sex-linked traits
gene located on a sex chromosome
sickle cell disease is an __________ dominant disease
?
linked genes
genes located on the same chromosome that tend to be inherited together
path of blood flow in humans
begins in pulmonary (LUNG) circuit.
1) right ventricle
2) pulmonary arteries
3) capillaries
4)pulmonary veins
5) left atrium
6)left ventricle
7) aorta
8) head, chest, arms, 2 legs
9) superior vena cava and interior vena cava
10) right atrium
testes
produce sprem. in male reproduction system.
where are capillaries found?
in blood vessles i think
nephridia
part of immune system...
sequence of waste passage through kidney pgs. 512- 513
?
color blindness on X chromosome possibilities
mostly males are affected...women woudl need 2 bad alleles but men only need 1 bad allele
replication (DNA) pg 189 or 129
DNA replication=
when proteins that start the process attach to the DNA and separate the strands. DNA polymerase occurs which is when nucleotides are added to the 3 inch side. Then DNA ligase takes place, which is an enzyme that links all the pieces back together.
Replication also happens in the mitotic phases. The cell cycle takes place which is when there is a growing stage (interphase) during which the cell roughly doubles everythign in its cytoplasm and dulicates its chromosomal DNA, and then the mitotic phase takes place which is the actual cell division.
what happens during transcription and translation?
scipt- transferres DNA to RNA
lation- RNA to protein
helper T cells pgs 497 & 499
play role in the immunity system. they help activate cytotoxic T cells and mcarophages and even help stimulate B cellsto produce antibodies.
where crossing over occurs
in meiosis in prophase I
sex-linked eye color flies pg 176
Red eyes=dominant
white eyes= recessive
white eyed males give recessive traits to female but not to male.
tracheal tubes
windpipe, portion of respiratory tube that has C shaped cartilegenous rings and passes from the larynx to the bronchi.
antibody-antigen recognition system?
the antigenetic determinant and antibody have complementary shapes
chromosome maps
crossing over has creater chance between farther apart loci
inversion
Change in a chromosome resulting from reattachment of a chromosome fragment to the orignial chromosome, but in a reverse direction. Mutagens and errors during meiosis can cause inversion.
addition
have disaterous effect. can alters reading frame of the messgae. result will be nonfunctional polypeptide
deletion
have disaterous effect. alters reading frame of the message. result will be nonfunctional polypeptide
non-disjunction
accident of meiosis or mitosis in which a pair of homolgous chromosomes or a pair of sister chromatids fail to seperate at anaphase.
Down syndrome
human genetic disorder resulting from the presence of an extra chromose 21. Characterized by heart and respiratory defects varying degrees of mental retardation
number of sex chromosomes
23
acetylcholine
released at neurotransmitters. is important in the brain and at synapses between motor neurons and muscle cells. This happens in the PNS. It also triggers an action potential.
alleles
alternative form of a gene
polygenes
?
somatic mutations 225 or 136
somatic cell is a cell that has 46 chromosomes...so a somatic mutation is one that produces a full- fledged cancer cell
Klinefelter Syndrome 147
found in individuals with more than one additonal sex chromosome, such as XXYY, XXXY, or XXXXY. These abnormal numbers of sex chromosomes probably result from multiple disjunctions; such men men are more likely to be mentally retarded than XY or XXY individuals.
why DNA fragmetns are separeted in electrophoresis
separate by size and electrical charge. Large moves slower and negative charge phosphate of the DNA goes to the positive end
selective breeding (153)
causes differences in their behavior. you CHOOSE to breed them.
autosomal traits are passed from ___________
one chromosome from each pair of our mother and the other form our father. They are also passedd from generation to generation.