Biology Study Guide

Front 1

process in which mRNA is used to make protein

Back 1

translation

Front 2

ex// of sex linked conditions

Back 2

red/ green colorblindness; Duchenne muscuar clystophy

Front 3

What a tetrad?

Back 3

structure consisting of 4 chromatids resulting from synapsis.

Front 4

anti-codon

Back 4

on a tRNA molecule, a specific sequence of 3 nucleotides thats complementray to a codon triplet on mRNA

Front 5

sex-linked traits

Back 5

gene located on a sex chromosome

Front 6

nucleotide

Back 6

an organic monomer consisting of a 5 carbon sugar covalently bonded to a nitrogenous base and a phosphate group. Nucleotides are the building blocks of nucleic acids.

Front 7

codon

Back 7

3 nucleotide sequence in mRNA that specifies a particular amino acid or polypeptide termination signal. Basic unit of genetic code.

Front 8

linked genes

Back 8

genes located on the same chromosome that tend to be inherited together

Front 9

what codes 4 an amino acid?

Back 9

codon

Front 10

transcription

Back 10

occurs in the nucleus. making of RNA on a DNA template

Front 11

path of blood flow in humans

Back 11

begins in pulmonary (LUNG) circuit.
1) right ventricle
2) pulmonary arteries
3) capillaries
4)pulmonary veins
5) left atrium
6)left ventricle
7) aorta
8) head, chest, arms, 2 legs
9) superior vena cava and interior vena cava
10) right atrium

Front 12

translation

Back 12

happens i teh cytoplasm. is the making of a polypeptide using the genetic info. encoded in an mRNA. Theres change of "language" from nucleotides to amino acids

Front 13

know how to match a complimentary DNA strand.

ATGCATGCTTAGTAGCTAGCATG

Back 13

ATGCATGCTTAGTAGCTAGCATG=
TACGTACGAATCATCGATCGTAC

Front 14

place of implantation of embryo

Back 14

?

Front 15

The role of tRNA

Back 15

functions as an interpreter. Each tRNA molecule has a specific amino acid and conveys the amino acid to the appropiate codon of mRNA.

Front 16

RNA? what does it contain? and what does it do?

Back 16

a type of nucleic acid consisting of nucleotide monomers w/ a ribose sugar, nitrogenous bases, AUC&G. Usually single stranded, function in protein synthesis and as the genes of some viruses.

Front 17

path of human fertilization

Back 17

?

Front 18

DNA? whats in it?

Back 18

genetic material that organisms inherit from their parents. Double strnaded helical macromolecule consisting of nucleotide monomers with deoxyribose sugar and nitrogenous bases ATC&G.

Front 19

where does replication take place?

Back 19

nucleus

Front 20

testes

Back 20

produce sprem. in male reproduction system.

Front 21

comparison of respiration of a grasshopper and earthworm

Back 21

the earhtworm takes place on outer skin layer and oxygen diffuses into thin cappilaries. Grasshopper- tracheal system which requires less energy than the earhtworm and consists of a bunch of airtubes

Front 22

insect excretory organs

Back 22

the insects excrte uraicke acid and urakite acid is non toxic but insoluable in water and is excreted as semi solid paste

Front 23

process in which mRNA is used to make protein

Back 23

translation

Front 24

genes that control blood type

Back 24

OAB or AB and is amde form 3 diff. alleles

Front 25

ex// of sex linked conditions

Back 25

red/ green colorblindness; Duchenne muscuar clystophy

Front 26

sex-linked traits

Back 26

gene located on a sex chromosome

Front 27

sickle cell disease is an __________ dominant disease

Back 27

?

Front 28

linked genes

Back 28

genes located on the same chromosome that tend to be inherited together

Front 29

path of blood flow in humans

Back 29

begins in pulmonary (LUNG) circuit.
1) right ventricle
2) pulmonary arteries
3) capillaries
4)pulmonary veins
5) left atrium
6)left ventricle
7) aorta
8) head, chest, arms, 2 legs
9) superior vena cava and interior vena cava
10) right atrium

Front 30

testes

Back 30

produce sprem. in male reproduction system.

Front 31

where are capillaries found?

Back 31

in blood vessles i think

Front 32

nephridia

Back 32

part of immune system...

Front 33

sequence of waste passage through kidney pgs. 512- 513

Back 33

?

Front 34

color blindness on X chromosome possibilities

Back 34

mostly males are affected...women woudl need 2 bad alleles but men only need 1 bad allele

Front 35

replication (DNA) pg 189 or 129

Back 35

DNA replication=
when proteins that start the process attach to the DNA and separate the strands. DNA polymerase occurs which is when nucleotides are added to the 3 inch side. Then DNA ligase takes place, which is an enzyme that links all the pieces back together.
Replication also happens in the mitotic phases. The cell cycle takes place which is when there is a growing stage (interphase) during which the cell roughly doubles everythign in its cytoplasm and dulicates its chromosomal DNA, and then the mitotic phase takes place which is the actual cell division.

Front 36

what happens during transcription and translation?

Back 36

scipt- transferres DNA to RNA
lation- RNA to protein

Front 37

helper T cells pgs 497 & 499

Back 37

play role in the immunity system. they help activate cytotoxic T cells and mcarophages and even help stimulate B cellsto produce antibodies.

Front 38

where crossing over occurs

Back 38

in meiosis in prophase I

Front 39

sex-linked eye color flies pg 176

Back 39

Red eyes=dominant
white eyes= recessive
white eyed males give recessive traits to female but not to male.

Front 40

tracheal tubes

Back 40

windpipe, portion of respiratory tube that has C shaped cartilegenous rings and passes from the larynx to the bronchi.

Front 41

antibody-antigen recognition system?

Back 41

the antigenetic determinant and antibody have complementary shapes

Front 42

chromosome maps

Back 42

crossing over has creater chance between farther apart loci

Front 43

inversion

Back 43

Change in a chromosome resulting from reattachment of a chromosome fragment to the orignial chromosome, but in a reverse direction. Mutagens and errors during meiosis can cause inversion.

Front 44

addition

Back 44

have disaterous effect. can alters reading frame of the messgae. result will be nonfunctional polypeptide

Front 45

deletion

Back 45

have disaterous effect. alters reading frame of the message. result will be nonfunctional polypeptide

Front 46

non-disjunction

Back 46

accident of meiosis or mitosis in which a pair of homolgous chromosomes or a pair of sister chromatids fail to seperate at anaphase.

Front 47

Down syndrome

Back 47

human genetic disorder resulting from the presence of an extra chromose 21. Characterized by heart and respiratory defects varying degrees of mental retardation

Front 48

number of sex chromosomes

Back 48

23

Front 49

acetylcholine

Back 49

released at neurotransmitters. is important in the brain and at synapses between motor neurons and muscle cells. This happens in the PNS. It also triggers an action potential.

Front 50

alleles

Back 50

alternative form of a gene

Front 51

polygenes

Back 51

?

Front 52

somatic mutations 225 or 136

Back 52

somatic cell is a cell that has 46 chromosomes...so a somatic mutation is one that produces a full- fledged cancer cell

Front 53

Klinefelter Syndrome 147

Back 53

found in individuals with more than one additonal sex chromosome, such as XXYY, XXXY, or XXXXY. These abnormal numbers of sex chromosomes probably result from multiple disjunctions; such men men are more likely to be mentally retarded than XY or XXY individuals.

Front 54

why DNA fragmetns are separeted in electrophoresis

Back 54

separate by size and electrical charge. Large moves slower and negative charge phosphate of the DNA goes to the positive end

Front 55

selective breeding (153)

Back 55

causes differences in their behavior. you CHOOSE to breed them.

Front 56

autosomal traits are passed from ___________

Back 56

one chromosome from each pair of our mother and the other form our father. They are also passedd from generation to generation.