Biology 100 Test 2

Front 1

DNA replication occurs

Back 1

to double the number of chromosomes prior to cell division

Front 2

Which phase of mitosis is associated with separation of sister chromatids?

Back 2

anaphase

Front 3

T/F A contributing factor to cancer is a mutation in a checkpoint gene

Back 3

True

Front 4

The actual splitting of a Eukaryotic cell is called

Back 4

cytokinesis

Front 5

Each chromosome has _________ centromere(s)

Back 5

1

Front 6

Condensed chromosomes are visible during

Back 6

Metaphase

Front 7

Meiosis, the division of sex cells, produces

Back 7

gametes

Front 8

Where do plants get the carbon they need to create sugar (and also to build more cells and to grow?)

Back 8

Air

Front 9

Which process is the Calvin Cycle used in?

Back 9

dark reaction of photosynthesis

Front 10

If you planted lots of trees around your house, during the day in the summer there would be an increase in the amount of _______________

Back 10

oxygen

Front 11

Which of the following pairings is/are correct?

Back 11

A.Glycolysis happens in the cytoplasm or cytosol
B. The Krebs Cycle happens in the mitochondria

Front 12

In Mendel's experiment, a cross of a heterozygous purple-flowered plant (Ww) with a homozygous white-flowered plant (ww) will produce _______________

Back 12

50% heterozygous purple-flowered offspring

Front 13

Which of the following is not true about the Krebs cycle?

Back 13

NADH is a output of the Krebs cycle

Front 14

Which part of the cell cycle differs the most between plants and animals?

Back 14

Cytokinesis

Front 15

We talked about 4 different methods for obtaining energy and carbon used by living organisms. As humans, we fall into which category?

Back 15

Chemoheterotroph

Front 16

T/F The physical appearance of an individual is called the phenotype.

Back 16

True

Front 17

During prophase of mitosis, which of the following happens? Three of the following answers are true and one is false or vice versa.

Back 17

DNA is replicated

Front 18

In humans, there are _______ chromosomes in cells undergoing Meiosis II.

Back 18

23

Front 19

Which of the following statements about meiosis is false?

Back 19

crossing over usually occurs between homologous chromosomes during prophase II

Front 20

Which of the following statements is true about gametes and somatic cells?

Back 20

The somatic cells of a parent contribute to the genetic makeup of its offspring

Front 21

Which of the following events take place during meiosis II

Back 21

sister chromatids separate from one another

Front 22

Chromosomes exist in somatic cells are nearly identical copies of each other called _________

Back 22

homologous chromosomes

Front 23

Sperm and eggs have a _____________ number of chromosomes

Back 23

haploid

Front 24

An alternate form of the same gene is called?

Back 24

allele

Front 25

Which of the following is not unique to meiosis

Back 25

reduction division

Front 26

T/F Cancer typically requires mutations to several different genes

Back 26

True

Front 27

Which of the following is a characteristic of anaphase?

Back 27

Sister chromatids split and begin moving to opposite sides of the cell

Front 28

During which part of the cell cycle is DNA polymerase (the protein that copies DNA) most active?

Back 28

S

Front 29

Which of the following is in the correct order? (mitosis/meiosis)

Back 29

Prophase, metaphase, anaphase, telophase

Front 30

Which of the following is NOT an assumption oft he Hardy-Weinberg Principle?

Back 30

selection occurs at low levels

Front 31

In the Hardy-Weinberg equation, p^2 is equal to

Back 31

the frequency of homozygous dominant genotype

Front 32

What is the difference between oncogenes and proto-oncogenes

Back 32

Oncogenes encode proteins that help a cell divide under unfavorable conditions

Front 33

In humans, straight thumbs are caused but eh dominant allele T, while individuals who are tt have thumbs that curve backwards. Consider a family in which the father has straight thumbs, and both the mother and their only child have curved thumbs. What is the chance that their next child will have curved thumbs?

Back 33

It is impossible to predict based on the information given

Front 34

Three of the following statement about photosynthesis are true and one is false or vice versa.

Back 34

sugar is made using the Krebs cycle in the dark reaction phase

Front 35

T/F Both oxidative metabolism (i.e. respiration) and photosynthesis have electron transport chains that create a hydrogen ion (H+) gradient and that gradient is the source of energy that drives ATP synthase

Back 35

True

Front 36

Three of the following statements about photosynthesis are true and one is false or vice versa.

Back 36

The light reactions harvest an electron from the oxygen of a water molecule

Front 37

Three of the following statements are true and one is false or vice versa.

Back 37

During respiration, O^2- is the final electron acceptor of the electron transport chain producing O2

Front 38

Which of the following statements is/are true?

Back 38

plants have mitochondria and respire

Front 39

Which of the following is not part of the chloroplast?

Back 39

none, all of the above are parts of the chloroplast

Front 40

There is a gene that codes for a protein that assures everything is ready to go during cell division and stops division if there is a problem. The name of the gene is _________

Back 40

checkpoint gene

Front 41

Dr. Krenz trapped gophers in a state park in Georgia. He captured 400 gophers and found that 36 of them were albinos (a trait controlled by a single recessive gene). If this population is in Hardy-Weinberg equilibrium, approximately how many of the gophers that Dr. Krenz captured were carriers of the recessive allele, but did not exhibit albinism?

Back 41

168

Front 42

From the problem above, what proportion of the population in the next generation will be homozygous dominant assuming all the assumptions of Hardy-Weinberg are met?

Back 42

0.70

Front 43

Translation is ______, and transcription is ________

Back 43

DNA to mRNA; mRNA to tRNA

Front 44

Suppose you have the following strand of DNA. If read by RNA Polymerase, this strand of DNA would lead to the following strand of RNA. DNA: AACTGCTACGACTACAACGTTATCTGCAATCTT

Back 44

UUGACGAUGCUGAUGUUGCAAUAGACGUUAGAA

Front 45

If read from left to right, the RNA strand coded for in question 44 would code for which of the following chains of amino acids

Back 45

Leu-Thr-Met-Leu-Met-Leu-Gin-Leu-Glu

Front 46

If there was a point mutation in the strand of DNA in question 44 such that the 4th base (T) were selected from the strand, the resulting strand of RNA would code for which of the following chains of amino acids?

Back 46

None of the above

Front 47

Which of the following most closely represents the process that occurs in the chloroplasts?

Back 47

CO2 + H2O + Light energy -> C6H12O6 + O2

Front 48

The location of a gene on a chromosome is called the

Back 48

locus

Front 49

How many different kinds of gametes can be made by an individual wight eh genotype AaBb?

Back 49

4

Front 50

________ is found on the mRNA and _______ is found on the tRNA, respectively.

Back 50

start codon, stop codon