Reading...
Play button
Play button
Use LEFT and RIGHT arrow keys to navigate between flashcards;
Use UP and DOWN arrow keys to flip the card;
H to show hint;
A reads text to speech;
376 Cards in this Set
- Front
- Back
|
What are the major basses of DNA and RNA?
|
Adenine, cytosine, guanine, thymine/uracil
|
|
|
Which bases make up the Purines?
|
Adenine and guanine
|
|
|
Which nitrogen in the Purines binds to the sugar to make up a nucleoside?
|
Nitrogen 9 or N9
|
|
|
Which bases make up the Pyrimidines?
|
Cytosine
DNA: Thymine RNA: Uracil |
|
|
Which nitrogen in the Pyrimidines binds to the sugar to make up a nucleoside?
|
Nitrogen 1 or N1
|
|
|
Ribonucleoside is composed of ?
|
Ribose + Base
|
|
|
What position on the ribose sugar binds to the nucleic base?
|
Position 1
|
|
|
What are the four ribonucleosides?
|
Adenosine
Guanosine Cytidine Uridine |
|
|
Deoxyribonucleosides are composed
of ? |
2-deoxyribose + base
|
|
|
What position on the 2-deoxyribose sugar bind to the nucleic base?
|
Position 2
|
|
|
What is the difference between ribose sugar and deoxyribose sugar?
|
The OH found on position 2 in ribose is replaced by a H in 2- deoxyribose
|
|
|
What are the four deoxyribonucleosides?
|
deoxyadenosine (dA)
deoxyguanosine (dG) deoxycytidine (dC) deoxythymidine (dT) |
|
|
What are the physical properites of nucleosides?
|
More soluble than nucleic bases
Neutral molecule at physiological pH |
|
|
Molecules containing nucleic bases absorb __________?
|
UV light
|
|
|
A nucleotide is composed of ?
|
Phosphate+ Pentose+ Base
|
|
|
Which phosphate will stay with a newly formed DNA molecule when the nucleotide started out as a tri-phosphate?
|
alpha phosphate (the one closest tot he pentose)
|
|
|
Give an example of a nucleotide.
|
adenosine3';5"-cyclic monophosphate
(cAMP) |
|
|
What are the physical properties of nucleotides?
|
More water soluble than nucleosides.
Carry negative charge(s) due to phosphate group(s). |
|
|
What are polynucleotides composed of?
|
A chain of nucleotides bound together. The chain will always have a 5' and a 3' ends.
|
|
|
What is the structure of DNA?
|
Two stranded, double helical structure
|
|
|
Another name for the DNA structure.
|
anti-parallel, complimentary structure
|
|
|
Which bond is stronger G-C or A-T and why?
|
G-C because it forms three hydrogen bonds. A-T only form two hydrogen bonds.
|
|
|
How many base pairs make up one turn in a DNA molecule?
|
Ten base pairs
|
|
|
The double helical structure of DNA is represented in what model?
|
Watson-Crick model
|
|
|
What direction is the double helix of DNA?
|
Right-handed
|
|
|
What are the two main stabilizing forces in the structure of DNA?
|
Base stacking
Hydrogen Bonds |
|
|
What is hydrophobic and hydrophilic in the DNA molecule?
|
The base containing core is hydrophobic while the sugar-phosphate exterior is hydrophilic.
|
|
|
High concentrations of _______ help stabilize the exterior structure of DNA give and example.
|
cations
Mg 2+ |
|
|
DNA is constantly being ___________.
|
Denatured for its role in many biological functions.
|
|
|
Denaturing of DNA cause several ________.
|
physical changes
|
|
|
What are the two main ways DNA is denatured?
|
Temperature Increase
Changes in pH (increase or decrease) |
|
|
What bonds of the DNA structure can be unintentionally broken in high temperature or low pH?
|
phosphodiester bonds
|
|
|
What is the preferred pH denaturing pathway?
|
Alkaline because it prevents the breakage of phosphodiester bonds
|
|
|
What is the maximum value of UV light absorbed by the nucleic bases?
|
260nm
|
|
|
Stacked bases absorb ______(more/less) UV light then unstacked bases.
|
up to 40% less
|
|
|
What will cause the midpoint temperature to be higher?
|
More GC content in the molecule.
|
|
|
What is characteristic of the base content of DNA under standard conditions of concentrations and ionic strength?
|
midpoint temperature (Tm)
|
|
|
During renaturation, formations of __________ is very slow.
|
First base pair
|
|
|
What are the two steps of renaturation?
|
Formation of nucleation site
Helix propagation |
|
|
When renaturing in the lab how should the temperature be controlled?
|
Temperature should be decreased slowly.
|
|
|
Hybridization occurs in :
|
DNA-DNA
RNA-RNA DNA-RNA |
|
|
A technique based upon the association of complementary polynucleotide that was developed for the detection and quantitation of specific sequences of target nucleic acid.
|
Hybridization
|
|
|
DNA-DNA
|
Southern blot
|
|
|
detect RNA by DNA probe
|
northern blot
|
|
|
DNA probe to detect protien
|
southwestern blot
|
|
|
A left-handed helix with a zigzagging backbone.
Not very stable Not common in cells found only under certain conditions. |
Z-DNA
|
|
|
Appeared under conditions of high humidity and low salt concentrations and was the basis of the Watson-Crick structure. DNA in living organisms is generally this.
|
B-DNA
|
|
|
Can be found under conditions of low humidity and high salt concentrations. It is shorter and thicker.
|
A-DNA
|
|
|
How many base pairs make up one helical turn in A-DNA?
|
11 base pairs
|
|
|
The structural polymorphisms of double-helical DNA depends on what?
|
The base compositions and on physical conditions.
|
|
|
Variations in DNA structure or conformation are favored by what?
|
specific DNA sequence motifs
|
|
|
Inverted repeats are also called?
|
panlindromes
|
|
|
Name the three DNA sequence motifs discussed in lecture.
|
Inverted, Mirror, Direct
|
|
|
GGAATCGATCTTAAGATCGATTCC is an example of what sequence motif?
|
Inverted (panlindrome) repeat
|
|
|
GGAATCGATCTTTTCTAGCTAAGG is an example of what sequence motif?
|
Mirror repeat
|
|
|
GGAATCGATCTTGGAATCGATCTT is an example of what type of sequence motif?
|
Direct Repeat
|
|
|
In inverted repeat structured DNA intra-strand hydrogen bonds can occur causing double helical structures with in the DNA structure. This would form what?
|
Cruciform Structured DNA
|
|
|
A DNA molecule containing three strands would be found in what shape?
|
Hoogensteen triple helix
|
|
|
The Hoogensteen triple helix is (more/less) stable than the Watson-Crick double helix. Why?
|
Less stable- three negatively charged backbone strands increase in electrostatic repulsion.
|
|
|
Triple helix formation is ________.
|
highly salt dependent
|
|
|
Intramolecular triple helices are referred to as?
|
H-DNA
|
|
|
Most (if not all) DNA in bacteria exists as ________.
|
Closed circles.
|
|
|
Generally are a few thousand base pairs long and encode accessory genes such as antibiotic resistance.
|
Plasmids
|
|
|
What shape do plasmids reside in?
|
closed circles
|
|
|
T/F Plasmids are maintained and replicated with chromosomal DNA.
|
False- Plasmids are maintained and replicated separately from chromosomal DNA
|
|
|
Circular DNA can also be found in what organelles of the cell?
|
Mitochondria and chloroplasts
|
|
|
Underwound (circular) DNA is _______ supercoiled.
|
Negatively
|
|
|
The resulting superhelix of a negatively supercoiled (circular) DNA is _______and is the form __________
|
right handed
normally found in cells |
|
|
Overwound (circular) DNA is ______ supercoiled.
|
Positively
|
|
|
A positvely supercoiled DNA forms a ______ superhelix
|
left handed
|
|
|
Regulates the formations of superhelices by catalyzing the concerted breakage and rejoining of DNA strands, which produces a DNA that is more or less superhelical than the original.
|
Topoisomerases
|
|
|
What relaxes DNA by breaking only one strand?
|
Topoisomerase I
|
|
|
What breaks both strands of DNA simultaneously?
|
Topoisomerase II
|
|
|
A subset of type II topoisomerase which are the only enzymes that add negative supercoils into DNA.
|
Gyrases
|
|
|
Bacterial chromosomes are packaged ______.
|
Nucleoids
|
|
|
Describe a nucleoid structure.
|
40-50 loops of supercoiled DNA organized by a central RNA-protein scaffold
|
|
|
The scaffold of the prokaryotic nucleoid structure is maintained by what?
|
Interactions between DNA and RNA
|
|
|
What completely unfolds the prokaryotic chromosome in a single step by disrupting the nucleoid core?
|
RNase
|
|
|
What relaxes the structure of the prokaryotic chromosome progressively by opening individual loops, one at a time?
|
DNase
|
|
|
Eukaryotic Chromatin is stored in what?
|
Polynucleosomes
|
|
|
Polynucleosomes' elementary unit is a ______.
|
Nucleosome
|
|
|
A nucleosome is composed of what?
|
A DNA sequence (146bp)
An octameric histone cluster |
|
|
An octameric histone cluster is composed of what?
|
two molecules each of H2A, H2B, H3, H4 histones
|
|
|
Histones are in contact with the __________ of DNA.
|
Minor groove
|
|
|
Polynucleosomes are composed of?
|
Numerous nucleosomes joined by "linker" DNA (20-90 bp long)
|
|
|
"Linker" DNA is in association with what?
|
histone H1
|
|
|
Hisotne H1 does what for the polynucleosome structure.
|
locks the coiled DNA in place.
|
|
|
A polynucleosome structure containing histone H1 is called what?
|
Chromatosome
|
|
|
How is topoisomerase involved in the coiling of DNA around the histone complex?
|
It relaxes the unbound positive supercoil so that only the negative bound supercoil exists.
|
|
|
Polynucleosomes are packaged into this higher structure.
|
30nm fiber or solenoid
|
|
|
The majority of eukaryotic DNA is what?
|
noncoding DNA
|
|
|
The human genome codes as few as how many genes?
|
30,000
|
|
|
What is the proposed purpose of noncoding DNA?
|
It may play a vital role in regulation of gene expression during development.
|
|
|
What is common in eukaryotic DNA that is rather limited in prokaryotic DNA?
|
repeated sequences
|
|
|
Noncoding intervening nucleotide sequences.
|
introns
|
|
|
The sequences in the gene that are expressed, either in final RNA product or as a protein.
|
Exons
|
|
|
What are the three major differences between DNA and RNA?
|
1) RNA contains Ribose as the nucleotide sugar component.
2) RNAs are generally single stranded. 3) uses Uracil rather than Thymine |
|
|
Why is RNA less stable than DNA?
|
Because hydrolysis of RNA is accelerated by participation of the 2'-OH group.
|
|
|
The secondary structure of RNA involves what?
|
Intramolecular Base pairing
|
|
|
Double-helical stem-loop regions in RNA are often called what?
|
"Hairpins"
|
|
|
The tertiary structure of RNA molecules results from what?
|
Base stacking and hydrogen bonding between different parts of the molecule.
|
|
|
Name the four types of RNA.
|
Transfer RNA (tRNA)
Ribosomal RNA (rRNA) Messenger RNA (mRNA) Catalytic RNA (ribozyme) |
|
|
What are the two roles of tRNA?
|
Activation Amino Acids
Recognizing Codons in mRNA |
|
|
Is part of the protein synthesis apparatus. Accounts for 80% of cellular RNA and is metabolically stable.
|
rRNA (ribosomal)
|
|
|
Carry the information for the primary structure of proteins.
|
mRNA
|
|
|
Enzymes whose RNA subunits carry out catalytic reactions are called what?
|
ribozymes
|
|
|
How many classes of ribozymes exist?
|
five
|
|
|
Three classes of RNA species carry out what sort of reactions.
|
self-processing
|
|
|
What two classes of RNA act as true catalysts, acting on separate substances?
|
ribonuclease P (RNase P)
rRNA |
|
|
A self-cleaving structure that is formed by the base-pairing of two separate RNAs.
|
Hammerhead ribozyme
|
|
|
What are the requirements of DNA Replication?
|
Template
Primer Precursors Enzymes |
|
|
What provides sequence information in DNA replication?
|
Template
|
|
|
What provides free 3'-OH to which nucleotides are added in DNA replication?
|
Primer
|
|
|
5'-deoxynucleoside triphosphates
(5' dNTPs) |
Precursors
|
|
|
Name the enzymes used in DNA replication (7)
|
1) DNA Polymerases
2) sliding clamps 3) helicases 4) primases 5) single-stranded DNA binding proteins 6) nucleases 7) ligases |
|
|
During replication, an incoming nucleoside triphosphate forms correct hydrogen bonds with template in the active site of a _________.
|
DNA polymerase
|
|
|
The 3'-OH of the replication primer attacks what phosphate of the nucleotide displacing what?
|
alpha phosphate of the nucleoside
displaces a pyrophosphate |
|
|
DNA Polymerases require what in DNA replication?
|
template, primer, and 5'dNTP(precursor)
|
|
|
DNA Polymerase ensures accuracy in what two ways?
|
1. Initial selection of proper nucleotide to add.
2. Enzymatic proofreading |
|
|
Enzymatic proofreading is accomplished by?
|
By a 3'-5' exonucleolytic activity that removes mispaired nucleotides from the 3' end of the chain.
|
|
|
DNA polymerase is labeled with what in E Coli?
|
Roman Numerals
|
|
|
DNA polymerase is labeled with what in Eukaryotic cells
|
Greek letters
|
|
|
Name the polymerases that act as the major replication polymerase in pro and eukaryotic cells.
|
Prokaryotic: Pol III
Eukaryotic: Pol delta |
|
|
The new strand with its 3'-OH orientated toward the fork can be elongated simply by sequential addition of new nucleotides.
|
Leading Strand
|
|
|
The new strand has its 5' end oriented toward the fork.
|
Lagging Strand
|
|
|
The small pieces from which the lagging strand is made. Average about 130-200 nucleotides in length in humans.
|
Okazaki Fragments
|
|
|
Parental strands of DNA separate, and each serves as a template for synthesis of a new (daughter) strand. Result is a pair of duplexes each containing one old and one new strand.
|
Semiconservative DNA Synthesis
|
|
|
What synthesizes an RNA primer for DNA replication?
|
Primase
|
|
|
What removes the RNA primer from the older okazaki fragment in eukaryotes and e. coli.
|
Eukaryotes: RNaseH
E. Coli: Pol I |
|
|
What seals the old and new okazaki fragments in DNA replication?
|
DNA Ligase
|
|
|
What is the "net" cost of DNA nick sealing in DNA replication?
|
one ATP
|
|
|
What enzyme is needed to separate parental strands of DNA under physiological conditions?
|
Helicase
|
|
|
What are needed to keep the separated DNA strands apart?
|
Single-stranded DNA binding proteins (SSB)
|
|
|
What enzymes aid in the untwisting of DNA?
|
Topoisomerases
|
|
|
What enzyme relaxes DNA by nicking one strand, passing the intact strand through the gap, and closing the gap.
|
Topoisomerases I
|
|
|
What enzyme makes transient breaks in both strands of DNA (slightly staggered) and allow a double helix to pass through?
|
Topoisomerases II
|
|
|
What enzyme makes DNA polymerase more processive, increasing the speed of synthesis and its accuracy?
|
Sliding Clamp
|
|
|
In the creation of a sliding clamp what binds to the DNA?
|
clamp-loading protien
|
|
|
Once attached to DNA the clamp-loading protein does what?
|
It assembles the sliding clamp from its subunits.
|
|
|
In E. Coli, what synthesizes the continuous strand and most of the discontinuous strand in DNA replication?
|
Pol III
|
|
|
In E. Coli, what removes RNA primer and fills the gap simultaneously in a process called nick translation?
|
Pol I
|
|
|
Pol I in E. Coli parallels what enzyme(s) in eukaryotic cells?
|
RNaseH and DNA Ligase working together
|
|
|
In E. Coli, what moves along the template for the lagging strand?
|
DNA helicase/primase complex
(DnaB/DnaG) |
|
|
In E. Coli, what synthesizes an RNA primer every 1000-2000 bp?
|
DnaG
|
|
|
In eukaryotes, What is a single-stranded DNA binding protein?
|
Replication Protein A (RPA)
|
|
|
In eukaryotes, what enzyme is composed of 10bp RNA that synthesizes a 15-30 bp DNA primer?
|
Poly alpha- Primase
|
|
|
In eukaryotes, what is known as the clamp loader?
|
Replication Factor C (RFC)
|
|
|
In eukaryotes, what forms a sliding clamp?
|
Three PCNA (proliferating cell nuclear antigen)
|
|
|
In eukaryotes, what enzyme synthesizes DNA?
|
DNA polymerase delta
|
|
|
In eukaryotes, what enzyme removes RNA primer leaving 1 nucleotide?
|
RNaseH
|
|
|
In eukaryotes, what enzyme peels and cleaves one or few nucleotides?
|
FEN 1 (Flap endonuclease)
|
|
|
ORC stands for what?
|
Origin recognition complex
|
|
|
MCM stands for what?
|
minichromosome maintenance proteins
|
|
|
Replication begins from what specific site?
|
origins of replication (ori)
|
|
|
Ori are composed of what?
|
multiple, short, repeated sequences that bind specific proteins
AT-rich regions at which the initial separation of parental strands occurs |
|
|
What is the difference between ori(s) in E. coli and eukaryotic cells?
|
E. Coli has only a single ori (oriC) whereas eukaryotic have thousands of origins.
|
|
|
What is the name of oris in yeast?
|
Autonomously replicating sequences (ARS)
|
|
|
DNA replication takes place during what phase in cell synthesis?
|
S-phase
|
|
|
Special structure at the end of eukaryotic linear chromosome, contains many repeats of a six-nucleotide, G-rich repeated sequence.
|
Telomere
|
|
|
A ribonucleoprotein complex that catalyzes the addition of new 6-nt repeats to the 3'end of a DNA chain.
|
Telomerase
|
|
|
What is the integral part of the telomerase structure?
|
the short RNA strand
|
|
|
What part of the telomerase serves as the template for the reaction?
|
the telomerase RNA
|
|
|
What part of the telomerase functions as a reverse transcriptase, synthesizing DNA using the template.
|
the protein component
|
|
|
The exchange of genetic information.
|
Recombination
|
|
|
What type of recombination occurs between identical or nearly identical sequences?
|
Homologous
|
|
|
The probability that a recombination event will occur between any two point on a chromosome is roughly proportional to what?
|
The physical distance between them.
|
|
|
A 1% frequence of recombination between two genes or markers is defined as what?
|
1 centimorgan (cM)
|
|
|
In humans 1 cM is approximately how many bp?
|
1,000,000
|
|
|
What are the key feature(s) of Holliday's model of homologous recombination?
|
1) homology
2) symmetry of both breaks and strand invasion 3) presence of a four-stranded "Holliday junction" as a key intermediate |
|
|
What are the key feature(s) of Meselson-Radding's model?
|
The asymmetrical heteroduplex that results from the invasion of one strand from one of the two duplexes.
|
|
|
What action initiates the double-strand break model?
|
One of the double-strands break in one DNA molecule
|
|
|
How many Holliday junctions are formed as intermediates in the double-strand break model?
|
two
|
|
|
What are the four possible outcomes of the double-strand break model?
|
Two leave flanking markers together
Two lead to the exchange of flanking markers. |
|
|
Specific enzymes catalyze the integration of a sequence into particular sites in the DNA during this form of nonhomologous recombination.
|
Site-Specific Recombination
|
|
|
The movement of specific pieces of DNA in the genome.(a nonhomologous recombination)
|
Transposition
|
|
|
What are the two key features of transposons?
|
1) they encode transposase enzymes
2) they have insertion sequences recognized by the transpsase. |
|
|
The random integrations of genes into the chromosomes by nonhomologous recombination. Is a major limitation to gene therapy at present.
|
Nonhomologous (illegitimate) Recombination
|
|
|
DNA Damage:
Converts C to U |
Oxidative deamination
|
|
|
DNA Damage:
Missing base on DNA strand but does not break sugar-phosphate backbone |
AP site usually caused by depurination
|
|
|
DNA Damage:
a highly mutagenic lesion |
O6-methyl guanosine
|
|
|
DNA Damage:
Leads to cross-linking of adjacent pyrimidines along one strand of DNA. |
Ultraviolet Light
|
|
|
What are the basic steps of excision repair?
|
Recognize
Remove Resynthesize Ligate |
|
|
Base excision repair:
What enzyme removes the base but leaves the backbone intact? |
Glycosylase
|
|
|
Base excision repair:
What enzyme cuts the backbone? |
AP endonuclease
|
|
|
Base excision repair:
What enzyme removes the sugar? |
AP lyase
|
|
|
Base excision repair:
What enzyme fills the gap? |
DNA polymerase
|
|
|
Base excision repair:
What enzyme seals the nick? |
DNA ligase
|
|
|
Is a specialized form of nucleotide excision repair that removes replication errors.
|
Mismatch repair
|
|
|
Recognition of mismatches relies on what?
|
The distortion of the double helical structure
|
|
|
T/F Newly synthesized DNA is not methylated.
|
True
|
|
|
T/F Mismatches are like DNA damage
|
False: mismatches are not like DNA damage. There is not damaged or modified base present, just the wrong one of the four bases.
|
|
|
Replication on a branch of the replication fork can be halted by what?
|
a Lesion
|
|
|
What process allows isopolar parental strand to fill the gap in the daughter strand, leaving a gap in the parental strand.
|
Recombination repair (daughter-strand gap repair)
|
|
|
The gap left on the parental strand of DNA after recombination repair can be filled by what?
|
DNA polymerase
|
|
|
After recombination repair is complete the lesion on the parent strand can be repaired by excision repair because why?
|
Because it is now opposite an intact strand
|
|
|
Can insert nucleotides opposite lesions in the template and thereby allow bypass of damage and synthesis of of nongapped daughter strands.
|
Specialized DNA polymerases
|
|
|
During bypass synthesis errors are introduced at a high frequency due to what?
|
Relaxation of proofreading
|
|
|
What is the main signal that DNA is damaged?
|
Single stranded DNA
|
|
|
What is a common repressor of DNA repair?
|
LexA
|
|
|
What activates RecA when binded to it?
|
Single strand DNA (ssDNA)
|
|
|
Activated RedcA aids in what?
|
cleavage of LexA
|
|
|
The process by which RNA chains are made form DNA templates
|
Transcription
|
|
|
Enzymes that catalyze transcription.
|
RNA polymerase
|
|
|
T/F RNA polymerase requires a primer
|
False-RNA polymerase does not require a primer
|
|
|
What are three parts of transcription?
|
Initiation
elongation termination |
|
|
What part of transcription is the major control of gene expression?
|
Initiation
|
|
|
What are the DNA sequence components associated with transcription?
|
Enhancer
Silencer Promoter |
|
|
What are the proteins component associated with transcription?
|
Activator
Repressor Transcription Factor |
|
|
DNA sequences that stimulate transcription but are located further away from the initiation site are called what?
|
Enhancers
|
|
|
T/F Enhancers stimulate the synthesis of some prokaryotic RNAs and of most, if not all, eukaryotic mRNAs
|
True
|
|
|
T/F Enhancers can only stimulate transcription if they are located at the beginning of the gene.
|
F- Enhancers sequences can stimulate transcription whether they are located at the beginning, in the middle, or at the end of a gene.
|
|
|
Define how a cis-acting relationship affects how an enhancer works.
|
An enhancer sequence must be on the same DNA molecule (chromosome) as is the transcribed gene.
|
|
|
T/F An enhancer can function in either orientation and at variable distance from their respective promoters.
|
True
|
|
|
What does the bonding of a protein activator to an enhancer do to the process of transcription?
|
Facilitates transcription by "recruiting" RNA polymerase to form an initiation complex.
|
|
|
Specialized DNA sequences required for transcription initiation. Located at a short distance upstream of the transcription start site.
|
Promoters
|
|
|
RNA polymerase synthesizes RNA in what direction?
|
5'-3' direction
|
|
|
Large multisubunit enzymes whose mechanisms are only partially understood.
|
RNA Polymerase
|
|
|
What are the four subunits of RNA polymerase, in E. coli, that make up the core enzyme?
|
2 alpha subunits
1 beta subunit 1 beta prime subunit |
|
|
A core enzyme is capable of doing what?
|
It is capable of faithful transcription but not of specific RNA synthesis.
|
|
|
What type of enzyme is created with addition of a gama subunit that is capable of specific RNA synthesis in vitro and in vivo.
|
holoenzyme
|
|
|
Clinical Correlate 5.1
What antibiotic inhibits the RNA polymerase in prokaryotes by binding to the beta subunit? |
Rifampicin
|
|
|
How is a "closed complex" formed in the process of transcription?
|
RNA polymerase holoenzyme binds weakly to the promoter DNA
|
|
|
What type of interaction exists in a "closed complex"?
|
Weak interactions
|
|
|
What is characterized by a local opening of about 10 bp of the DNA double helix when the holenzyme forms a more tighter bond?
|
"open complex"
|
|
|
What aides in the process of unwinding and restoring of the DNA double helix?
|
DNA topoisomerases I and II
|
|
|
T/F One gene can interact with multiple RNA polymerases.
|
True
|
|
|
What are the three steps needed for transcription initiation?
|
1. Chromatin containing the promoter sequence must be made accessible to the transcription machinery.
2. Transcription factors must bind to DNA sequence in the promoter region for a gene to be active. 3. Enhancers bind other protein factors (activators) to stimulate transcription. |
|
|
What does the term DNase I hypersensitivity mean?
|
An active gene has a generally "looser" conformation than transcriptionally inactive chromatin which enhances accessibility of promoter sequence.
|
|
|
A promoter of mRNA synthesis that is centered about 25 bp upstream from the transcription unit.
|
TATA box
|
|
|
A promoter of mRNA that is located further upstream then the TATA box. Also less conserved then the TATA box.
|
CAAT box
|
|
|
T/F One gene can interact with multiple RNA polymerases.
|
True
|
|
|
What are the three steps needed for transcription initiation?
|
1. Chromatin containing the promoter sequence must be made accessible to the transcription machinery.
2. Transcription factors must bind to DNA sequence in the promoter region for a gene to be active. 3. Enhancers bind other protein factors (activators) to stimulate transcription. |
|
|
What does the term DNase I hypersensitivity mean?
|
An active gene has a generally "looser" conformation than transcriptionally inactive chromatin which enhances accessibility of promoter sequence.
|
|
|
What is responsible for the synthesis of mRNA in the nucleus?
|
RNA polymerase II
|
|
|
What is responsible for the synthesis of rRNA (rate-limiting fro cell growth)?
|
RNA polymerase I
|
|
|
What is responsible for the transcription of 5s RNA and tRNA?
|
RNA polymerase III
|
|
|
What binds to a sequence located within the coding sequence for the gene for 5s rRNA?
|
Transcription factor (TFIIIA)
|
|
|
What are the three steps in tRNA processing?
|
Cleavage
Addition Modification |
|
|
What are the enzymes involved in the cleavage of tRNA?
|
RNase P
Exonulcease Endonuclease ligase |
|
|
What enzyme eats up nucleotides one by one from the outside end?
|
Exonuclease
|
|
|
What enzyme comes in the middle of tRNA and cleaves?
|
Endonuclease
|
|
|
What is added to tRNA in its processing and what adds it?
|
CCA-3'
tRNA nucleotidyltransferase |
|
|
What role does the CCA-3' tail have in tRNA?
|
It interacts with the amino acids
|
|
|
What is the primary product of rRNA transcription?
|
a long RNA termed: 45S RNA
|
|
|
What sequences are contained within 45S RNA?
|
28 S
5.8 S 18 S |
|
|
Processing of 45S RNA occurs where in the cell?
|
Nucleolus
|
|
|
Processing of 45S RNA is carried out by what?
|
Large multisubunit ribonucleoprotein assemblies
|
|
|
What sequence specifies cleavage of mRNA precursor in eukaryotic cells?
|
Poly (A) signal sequence- AAUAAA
|
|
|
What par to mRNA is a primer for poly (A) synthesis?
|
The free 3'-OH end
|
|
|
What carry out the dual steps of RNA splicing?
|
Small nuclear ribonucleoproteins (snRNPs)
|
|
|
What are the dual steps of RNA splicing?
|
1) Breakage of the intron at the 5' donor site
2) Joining the upstream and downstream exon sequences together |
|
|
All introns begin with what sequence and end with what sequence?
|
Begin: GU
End: AG |
|
|
The GU and AG sequences in RNA introns are called what?
|
Donor and acceptor intron-exon junctions
|
|
|
What RNA recognizes the donor GU sequence of a RNA intron?
|
U1 RNA
|
|
|
What RNA recognizes the important sequences at the 3' acceptor end of the RNA intron?
|
U2 RNA
|
|
|
What type of tail does mRNA have?
|
a 3' poly A tail
|
|
|
What can lead to multiple proteins being made form a single gene?
|
Alternate pre-mRNA splicing
|
|
|
What is an RNAse III nuclease that cleaves double-stranded RNA (dsRNA) and pre-microRNA(miRNA)?
|
Dicer
|
|
|
Made up of about 21 bp can be packaged into RISC or miRNP
|
Small inhibitory RNAs (siRNA)
|
|
|
An enzyme complex whose catalytic component argonaute is an endonuclease capable of degrading messenger RNA.
|
RNA-induced silencing complex (RISC)
|
|
|
An enzyme complex that stops translation of mRNA
|
micro-RNA-protein (miRNP)
|
|
|
RNA is not like DNA because...
|
it is constantly being made and degraded.
|
|
|
Removal of RNAs from the cytoplasm is accomplished by what?
|
cellular ribonucleases (RNAse)
|
|
|
T/F RNA molecules are generally stable.
|
False- They are generally unstable.
|
|
|
Encoding a single poylpetitdes
|
monocistronic
|
|
|
Encoding several polypeptides
|
polycistronic
|
|
|
What are the two main differences between Eukaryotic and prokaryotic mRNA
|
1) Euk, 5'-end is capped whereas prok. 5'-end is not capped.
2) Euk. has a polyadenylate tail where as prok. does not have a polyadenylate tail. |
|
|
What is the translational intiation signal for eukaryotic mRNA
|
Usually the first AUG
|
|
|
What direction is the eukaryotic mRNA read?
|
5'- to-3'
|
|
|
What role does the cap on the 5' end of the eukaryotic mRNA play?
|
It plays a role in the stability of the molecule.
|
|
|
Uses a four-letter alphabet of nucleotides.
|
Genetic Code
|
|
|
in mRNA are three-letter words
|
Codons
|
|
|
Usually which nucleotide is different in the multiple codons that code for the same amino acid?
|
The third nucleotide
|
|
|
Name the three stop codons.
|
UAA
UAG UGA |
|
|
Codons are nearly universal in prokaryotic and eukaryotic cells except in what?
|
the mitochondria
|
|
|
How many codons are in the genetic code?
|
64
|
|
|
What are the four nonuniversal codons?
|
UGA
AUA AGA AGG |
|
|
Involves a change in a single base pair in the DNA, and thus a single base in the corresponding mRNA.
|
Point Mutations
|
|
|
If a point mutation occurs int he third position of a degenerate codon, there may be no change in the amino acid specified.
|
Silent Mutations
|
|
|
Arise from a base change that causes incorporation of a different amino acid in the encoded protein.
|
Missense Mutations
|
|
|
Formation of a termination codon from one that encodes an amino acid.
|
Nonsense Mutation
|
|
|
Mutation of a termination codon to one for an amino acids allows the message to be converted until another stop codon is encountered.
|
"Read Through" Mutations
|
|
|
Insertion or deletion of a nucleotide causes what type of mutation?
|
Frameshift Mutations
|
|
|
Translation of the codons of mRNA involves their direct interaction with complementary _________ in tRNA.
|
anticodon sequences
|
|
|
Codon-anticodon base pairing is what?
|
antiparallel
|
|
|
The process of activating proteins and linking them to their appropriate tRNA carriers is catalyzed by what family of enzymes?
|
aminoacly-tRNA synthetases
|
|
|
Complex ribonucleoprotein particles made up of two dissimilar subunits each of which contains RNA and many proteins. Proteins are assembled here.
|
Ribosomes
|
|
|
peptidyl-tRNA binding site
|
P site
|
|
|
acceptor site or aminoacyl-tRNA binding site
|
A site
|
|
|
Exit site for growing peptide chain.
|
E site
|
|
|
What binds to GTP and an initiator species of tRNA met.
|
Eukaryotic initiation factor 2a (eIF-2a)
|
|
|
What initiation factor serves as RNA helicase?
|
Eukaryotic initiation factor 4a (eIF-4a)
|
|
|
What initiation factor is also called the cap binding protein?
|
Eukaryotic initiation factor 4f (eIF-4f)
|
|
|
What does PAB stand for?
|
polyA-binding protein
|
|
|
What makes u p the completed initiation complex for elongation in eukaryotes?
|
tRNA& amino acid
GTP EF-1alpha |
|
|
When a termination codon in mRNA occupies what site, binding of what occurs and what is released
|
A site
release factor(eRF)-GTP complex deacylated tRNA |
|
|
What functions as a hydrolase in termination of protein biosynthesis?
|
Peptidyltransferase
|
|
|
How many high-energy bonds are broken per peptide bond formed?
|
four
|
|
|
What reversibly bind hydrophobic regions of unfolded proteins and folding intermediates?
|
Protein Chaperones
|
|
|
What are five things that protein chaperones can do?
|
1. stabilize intermediates
2.maintain proteins in an unfolded state to allow passage through membranes 3. help unfold misfolded segments 4. prevent formation of incorrect intermediates. 5. prevent inappropriate interactions with other proteins. |
|
|
Failure to fold correctly usually lead to what?
|
Rapid protein degradation
|
|
|
Accumulation of misfolded proteins can result in what?
|
Protein aggregation and serious diseases.
|
|
|
Proteins destined for export are synthesized where?
|
On membrane-bound ribosomes of the rough endoplasmic reticulum (ER)
|
|
|
What have a hydrophobic Signal peptide usually at or near the amino terminus?
|
Secretory Proteins
|
|
|
What are the characteristics found in signal peptide sequences?
|
positively charged N-terminal region
Core of 8-12 hydrophobic amino acids polar C-terminal segment |
|
|
An elongated particle made up of six different proteins and a small (7s) RNA molecule.
|
Signal Recognition Particle (SRP)
|
|
|
Binding of signal peptide in a hydrophobic pocket of the SRP with the positively charged N-terminal segment in contact with SRP RNA does what?
|
Orients the ribosome and halts protein synthesis
|
|
|
Occurs as the protein is being synthesized and it can affect protein folding.
|
N-linked glycosylation
|
|
|
Occurs only after the protein has reached the Golgi apparatus. Is posttranslational and occurs only on fully folded proteins.
|
O-linked glycosylation
|
|
|
What is one way in which cells adjust to changes in their environment?
|
By altering their expression of specific genes
|
|
|
Example is insulin is synthesized in beta cells of the pancreas
|
Tissue specific gene expression
|
|
|
In E.coli the genes that code for the enzymes of a specific metabolic pathway are found where?
|
clustered in one region of the DNA
|
|
|
Genes for associated structural proteins are frequently found where?
|
adjacent to one another
|
|
|
Members of a set of clustered genes are usually what?
|
coordinately regulated and transcribed together to form a "polycistronic" mRNA species
|
|
|
Contains the coding sequences for several proteins.
|
"polycistronic" mRNA
|
|
|
The complete regulatory unit of a set of clustered genes.
|
operon
|
|
|
What makes up an operon?
|
Structural genes
Regulatory genes Control elements |
|
|
Code for the related enzymes or associated proteins
|
structural genes
|
|
|
code for regulator proteins
|
regulatory genes
|
|
|
sites on the DNA near the structural genes at which regulatory proteins act.
|
Control elements
|
|
|
A single mRNA species containing the coding sequences of all three structural genes is transcribed for a ?
|
promoter
|
|
|
The lactose repressor has a high affinity for what part of the Lactose operon?
|
operator
|
|
|
The promoter sequence on the lactose operon is composed of what?
|
Cap site
RNA polymerase interaction site |
|
|
What two molecules control transcription of the lac Operon?
|
glucose and lactose
|
|
|
Increased lactose levels lead to what?
|
increase concentration of allolactose which binds to the lac repressor and induces the operon
|
|
|
Increased levels of glucose lead to what?
|
Glucose inactivates adenylyl cyclase which is needed to bind to the activator to induce the lac operon.
|
|
|
Has a high affinity for the rRNA and a lower affinity for one or more regions of its own mRNA
|
"regulatory" ribosomal protein
|
|
|
If what is not available for assembly of new ribosomal subunits, individual ribosomal proteins bind to what causing what?
|
free rRNA
polycistronic mRNA from their own operon blocking further translation. |
|
|
Genes that are expressed in most cells
|
"housekeeping" genes
|
|
|
In eukaryotes gene expression occurs in three different forms
|
1.housekeeping genes
2.activated upon demand genes 3.genes rendered permanently inactive in all but a few cell types. |
|
|
Genes that are not transcribed with in a particular cell form what?
|
highly condensed heterochromatin
|
|
|
Transcriptionally active regions of DNA have what type of structure?
|
less condensed, more open structure
|
|
|
Modifications of what on the histones weakens the electrostatic interactions between the octamer core and the DNA
|
lysines
|
|
|
How does modification of lysines cause weakened electrostatic interactions between the octamer core and the DNA?
|
Lysine is modified by acetylation which replaces the positive charge of lysine with a neutral acetyl group which now does not interact with the negatively charged phosphodiester linkages of DNA.
|
|
|
What percent of CG sequences in human DNA are methylated?
|
70%
|
|
|
Methylation of DNA often correlates with what?
|
Lack of transcriptional activity
|
|
|
The methylation of DNA prevents what?
|
Binding of transcription factors
|
|
|
What are the two different means of repression of transcription at a specific location?
|
Methylation of DNA
Deacetylation of histones |
|
|
Methylation in human DNA centers on the formation of what?
|
5-methylcytosine from cytosine in the sequence CG on both strands
|
|
|
Hypermethylation of DNA is a common feature in what cells?
|
Cells of cancerous tissue
|
|
|
In fertilized eggs and very early embryos DNA undergoes what?
|
fairly global demethylation
|
|
|
Name the domains of eukaryotic transcription factors
|
DNA recognition domains
Activation domains Dimerization domains Protein interaction domains Domains that bind to coactivators |
|
|
Participate in site-specific binding
|
DNA recognition domains of transcription factors
|
|
|
contact general transcription factors, RNA polymerase II, or other regulators of transcription.
|
Activation domains of transcription factors
|
|
|
Promote the formation of homodimers or heterodimers with another monomeric transcription factor.
|
Dimerization domains of transcription factors
|
|
|
allow associations with other proteins such as histone acetylase
|
protein interaction domains
|
|
|
Name the four different DNA binding domains
|
1. Helix-turn-Helix(HTH)
2. Zinc finger 3. Helix-loop-helix (HLH) 4. Leucine zipper (bZIP) |
|
|
Name the three different Activation domains
|
1. acidic domain
2. glutamine-rich domain 3. proline-rich domain |
|
|
One helix binds to the major grove of double stranded DNA. The other helix bind to the sugar phosphate backbone. Recognize palindrome DNA sequences such as GTCGAC
|
Helix-turn-Helix (HTH) structural motif
|
|
|
Contains a repeating motif of a Zn+2 atom bonded to 2 histidine and 2 cysteine side chains.
|
Zinc finger Motif
|
|
|
Composed of an alpha-helix that contains at least 4 leucines arranged in the following primary sequence: Leu-X6-Leu-X6-Leu-X6-Leu-X6 where x is any amino acid
|
Leucine Zipper motif
|
|
|
T/F The Leucine-Zipper motif does bind directly to DNA
|
False-The leucine-zipper motif does not directly bind to the DNA. The DNA binding domain is adjacent to the zipper motif toward the amino terminus of the protein.
|
|
|
Brings together two monomers to form a dimer that binds to DNA.
|
Helix-loop-helix motif
|
|
|
What makes up the preintiation complex in eukaryotes?
|
Transcription Factors
RNA polymerase II DNA (TFIID) |
|
|
TFIID is a multisubunit complex that contains what?
|
The protein TBP (TATA) binding protein
Number of different TAFs (TBP-associated factors) |
|
|
What serves to stabilize the TFIID-DNA interaction?
|
TFIIA
|
|
|
What provides an appropriate interaction site for the binding of RNA pol II?
|
TFIIB
|
|
|
What is thought to destabilize nonspecific RNA polymerase II-DNA interactions thus targeting the RNA polymerase II to the growing initiation complex?
|
TFIIF
|
|
|
Is thought to have roles in transient opening of the DNA to provide a single stranded template for RNA polymerase to copy, and also in the phosphorylation of the CTD of RNA polymerase II, which is required for the polymerase to leave the initiation complex and facilitate transcription.
|
TFIIH
|
|
|
The presence of absence of the transcription factor determines what?
|
the activity
|
|
|
LDL receptor gene is transcribed in response to what?
|
the lack of cellular cholesterol
|
|
|
Increased transcription of the LDL receptor gene leads to what?
|
An increased amount of the LDL receptor protein and enhanced uptake of LDLs and their cholesterol in the blood
|
|
|
The modular Sp1 protein involved with LDL receptor gene transcription has what which assist in the recruitment of TFIID to the TATA box?
|
zinc finger motif
glutamine-rich activation domain |
|
|
The recruitment of TFIID to the TATA box by Sp1 requires what cofactor for activation?
|
CRSP
|
|
|
Activation of LDL gene transcription also requires what?
|
SREBP-1a
|
|
|
SREBP-1a is what?
|
sterol responsive element-binding protein.
a helix-loop-helix-leucine zipper transcription factor that binds to the sterol response element sequence. |
|
|
Polymerase Chain Reaction(PCR) is similar to what biological process?
|
DNA replication
|
|
|
PCR requires what?
|
Template
Two primers dNTPs Thermal stable ploymerase |
|
|
Recombinant DNA and Cloning depend upon what two types of enzymes?
|
Restriction enzymes: cleave DNA at specific locations
Liagaes: connect DNA back together |
|
|
DNA sequencing is similar to what biological process?
|
DNA replication
|
|
|
DNA sequencing requires what?
|
Primer
Polymerase dNGTP |
|
|
Transgenic Animals are used to
|
test protein function
|
|
|
In the knockout mouse what is done?
|
a gene is completely removed to see its effect on the animal's make up
|
|
|
Nick translation to label DNA probes is related to what biological process?
|
DNA replication
|
|
|
Electophoretic Mobility Shift Assay is used to see what?
|
See what is interacting with DNA and mutate active site
|
|
|
Nuclease protection assay is used to do what?
|
detect mRNA
|
