Plasmid

purified. The plasmid mini-preparation was done using the Qiagen kit to create a solution with purified plasmid DNA. Restriction enzyme digestion reactions used 8 μl of purified plasmid DNA, the EcoRV enzyme, and a cocktail [2]. Then agarose gel electrophoresis, using 1% agarose gel, was done on the digested plasmids [3]. Agarose gel electrophoresis displays the distances that the products had traveled, thus revealing the size of the products. This technique determined if the plasmid digestion…

Humans have been selectively breeding and cross breeding plants and animals almost as long as agriculture has been around. Recent advances in technology have allowed for people to modify an organism’s DNA in a way that would not occur naturally. GMO stands for genetically modified organisms, organisms that have been altered at the gene level. The main reason that GMO’s were created is for food for human consumption and medicine. With the increase in the world’s population and the hope for new…

First step is to determine the total mass of plasmid DNA used. Then, calculate the total volume of cell suspension prepared. Next, calculate the fraction of the total cell suspension that was spread on the plate. Next, determine the mass of plasmid DNA in cell suspension (total mass of plasmid DNA x fraction spread). Final and fifth step is to determine the number of colonies per μg of plasmid DNA (number of colonies observed/step 4) .Below are the example calculations…

Bacteria often contain plasmids, plasmids are circular, double stranded DNA that is not part of the nuclear DNA. Plasmids usually contain genes that code for several traits. Genetic transformation relies on inserting a gene that codes for a new trait in to the plasmid. For this lab, genetic transformation is the insertion of a new DNA in to E.coli cells, the pGLO plasmid was genetically engineered to carry the green fluorescent protein and a gene that codes for a protein that gives the bacteria…

the desired plasmid to be later added to a bacterium to mass produce amylase to cure the zombie plaque. This process would be complete over the time span of a week in a laboratory. This would be done by using two restriction enzymes (Hind3 and Bam1) to cut out the rfp gene (gene that produces amylase) out of the pKAN plasmid and glue it into the pARA plasmid to later be placed in a bacterium to basically infect the bacteria with the pARA plasmid to later produce amylase. The pARA plasmid is used…

PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX,…

Upon completion of the PCR, the final product should be highly concentrated DNA corresponding to the gene of interest. We ran our gene of interest on gel electrophoresis to compare our gene of interest to a marker of known size to confirm the size of our genomic DNA. On the image of the gel (figure 1), the sample containing the DNA ran, but the sample containing the DNA ladder did not. As a result, an appropriate determination of the sizes cannot be made because there is no ladder to compare it…

The two types of bacteria are archaebacteria and eubacteria. What characteristics distinguish these two groups from the other kingdoms? These two groups are different from other kingdoms because all cells in these kingdoms are single-celled organisms whose organelles are not membrane bounds. They are also microscopically small. What is the average size of a bacterium? An average bacterium is about 1-2 micrometres long. How many prokaryote species have been discovered? How many are estimated to…

This is important in determining physiological effects A stable transfection allows the plasmid to remain in the cell genome, in contrast to transient transfection where expression is limited due to eventual degradation. The plasmid integrates into the genome of the transfected cell, and becomes part of the cell line, passing on during replication8. Different reagents and other physical tools involving electrochemical…

combining two or more strands of DNA, scientists form a new strand of DNA. Gene Transfer using Plasmids • In order to transfer one strand of DNA from one species to another, a host cell is needed. E. coli is often used as a host cell for gene transfer because it not only has circular DNA, but also a smaller ring of independent, self-replicating DNA called a plasmid. • Plasmids are removed from a cell and broken apart using a restriction endonuclease. Restriction endonucleases…