According to http://www.encyclopedia.com, DNA which stands for deoxyribonucleic acid is used for human genetic makeup. It has different sequences of bases and exist in human body. The sequence of it nucleotides are A, T, G, C; or, adenine, thymine, guanine, and cytosine, respectively. A DNA fingerprinting, is a DNA pattern that has a unique sequence such that it can be distinguished from the DNA patterns of other individual. The two major uses for the information is for personal identification…
In the first infected group of mice, after a month, the mice were killed and the CD4+ T cells were purified from the spleen to be sequenced. They extracted the DNA using the MasterPureTM DNA purification kit and then subjected the CCR5 ZFN binding site to PCR amplification for 25 cycles. After PCR amplification and gel purification the sequence was subject to a modified Surveyor nuclease assay to determine CCR5 disruption frequency. Surveyor nuclease assays are used to detect single base…
PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX,…
Katherine Sanders BIOL-1406 Dec. 4, 2017 Formal Lab Report I. Purpose / Objectives The purpose of this lab was to imitate natural selection in a controlled environment. II. Hypotheses Hypothesis 1 – Size Null: There will be no difference in which of the beans will be picked first, based on size. Alternative: The smaller beans will be more likely to be picked last, therefore, they will survive and reproduce. Hypothesis 2 – Color Null: There will be no difference in which of the…
Such a protease was identified in the latex of Vallaris solanacea. Further study aimed at performing preliminary investigations on protease, purification, molecular weight determination and further characterization of Vallaris solanacea derived protease solanain [29]. The latex of Vallaris solanacea has high proteolytic activity, the activity being comparable to those of other known latex proteases such as papain…
Regeneration is the process of renewal or restoration of a body, part of the body or biological system after a wound or as a normal process. It is the process that makes the genomes, cells and organisms flexible to natural changes that cause disturbances or damage. All species are able to regenerate from bacteria to humans. Regeneration can be of two types: it can be complete when the new tissue is equal to the lost or incomplete tissue when the necrotic tissue presents fibrosis. Different…
1.2 Cellular DNA Damage responses, genomic instability. DNA is the blue print of life and all the information of life processes such as growth, metabolism, reproduction etc are encoded in the sequence of it. Therefore its very important to maintain the genomic integrity of this genetic material, not only to keep away defects in life processes but to pass a faithful information to the next progeny. Integrity of the DNA is usually challenged by both endogenous and exogenous agents who are capable…
Medicinal plant is an organism of the kingdom Plantae; now specifically, a living organism of the embryophyta (land plants) or of the chlorophyta (green algae), a eukaryote that includes double-membrane bounded chloroplasts in its cells containing chlorophyll a and b. Medicinal plants contain a large variety of chemical substances that possesses important therapeutic properties used in the treatment of many diseases. Increasingly industrialized societies are developing drugs and…
DNA organization within cells is a complex and sophisticated process. This high level of complexity is due to the hundreds of thousands of interactions that can be enabled through organization. It is a known that promoter elements and enhancer elements work in unison to regulate gene expression. Often times enhancers are found hundreds of kilo-bases away from their interacting promoter elements. These enhancers initiate promoter activation via interactions amongst transcription factor binding…
Plants reproduce by asexual reproduction or pollination in most cases, they do this in order to make seeds. Seeds are the embryonic, or unborn, state of a plant. These seeds are made to carry the genetic material and make new plants. In most cases a plant wants its seeds to be spread of moved to a new place not close to the parent plant, this is done through seed dispersal. There are many types of seed dispersal for example wind, water, animals, and other biotic and abiotic factors. One of the…