Molecular beam epitaxy

PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX,…

Katherine Sanders BIOL-1406 Dec. 4, 2017 Formal Lab Report I. Purpose / Objectives The purpose of this lab was to imitate natural selection in a controlled environment. II. Hypotheses Hypothesis 1 – Size Null: There will be no difference in which of the beans will be picked first, based on size. Alternative: The smaller beans will be more likely to be picked last, therefore, they will survive and reproduce. Hypothesis 2 – Color Null: There will be no difference in which of the…

Such a protease was identified in the latex of Vallaris solanacea. Further study aimed at performing preliminary investigations on protease, purification, molecular weight determination and further characterization of Vallaris solanacea derived protease solanain [29]. The latex of Vallaris solanacea has high proteolytic activity, the activity being comparable to those of other known latex proteases such as papain…

Regeneration is the process of renewal or restoration of a body, part of the body or biological system after a wound or as a normal process. It is the process that makes the genomes, cells and organisms flexible to natural changes that cause disturbances or damage. All species are able to regenerate from bacteria to humans. Regeneration can be of two types: it can be complete when the new tissue is equal to the lost or incomplete tissue when the necrotic tissue presents fibrosis. Different…

1.2 Cellular DNA Damage responses, genomic instability. DNA is the blue print of life and all the information of life processes such as growth, metabolism, reproduction etc are encoded in the sequence of it. Therefore its very important to maintain the genomic integrity of this genetic material, not only to keep away defects in life processes but to pass a faithful information to the next progeny. Integrity of the DNA is usually challenged by both endogenous and exogenous agents who are capable…

Medicinal plant is an organism of the kingdom Plantae; now specifically, a living organism of the embryophyta (land plants) or of the chlorophyta (green algae), a eukaryote that includes double-membrane bounded chloroplasts in its cells containing chlorophyll a and b. Medicinal plants contain a large variety of chemical substances that possesses important therapeutic properties used in the treatment of many diseases. Increasingly industrialized societies are developing drugs and…

DNA organization within cells is a complex and sophisticated process. This high level of complexity is due to the hundreds of thousands of interactions that can be enabled through organization. It is a known that promoter elements and enhancer elements work in unison to regulate gene expression. Often times enhancers are found hundreds of kilo-bases away from their interacting promoter elements. These enhancers initiate promoter activation via interactions amongst transcription factor binding…

Plants reproduce by asexual reproduction or pollination in most cases, they do this in order to make seeds. Seeds are the embryonic, or unborn, state of a plant. These seeds are made to carry the genetic material and make new plants. In most cases a plant wants its seeds to be spread of moved to a new place not close to the parent plant, this is done through seed dispersal. There are many types of seed dispersal for example wind, water, animals, and other biotic and abiotic factors. One of the…

3.0 MATERIALS AND METHODS 3.1 Materials The main material that used was sodium dodecyl sulphate and Zebrafish embryo. SDS was purchased from Sigma Aldrich with concentration of 99.95%. The embryo of the zebrafish larva was obtained by breeding the adult zebrafish in the laboratory. Furthermore, the other basic materials that was used including aquarium tanks, breeding tanks, water filter, fish food pellet and Instant Ocean Salt. While for the measurement tools that used were pH meter, cylinder,…

6F4Z1003- Genetics, Adaptation and Diversity Practical Report Section 1- Calculations and Pedigrees 1. In DNA extraction the proteins absorb light at 260nm and 280nm, especially the aromatic acids. 2. 250µg to nm, 250 x 1000 = 250,000ng. 3. 200ng/ml = 0.2µg/ml. 150µg/ml = 150,000µg/ml 250,000pg/µl = 250µg/ml 1mg/ml = 1000µg/ml ● 150,00µg/ml - HIGHEST CONCENTRATION OF DNA ● 1000µg/ml ● 250µg/ml ● 0.2µg/ml - LOWEST CONCENTRATION OF DNA 4. Sodium dodecyl sulphate is used as a…