PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX,…
Introduction Gastric volvulus is a rare but potentially life threatening condition that is defined by the pathological rotation of the stomach. There are many factors that contribute to the pathophysiology of this condition, for example laxity of the gastric ligaments. Gastric volvulus can be categorized according to the axis of the rotation and may result in an organoaxial, mesenteroaxial, or combined volvulus of the stomach1. This condition can be primary or secondary, with secondary being…
by tranpeptidase and D-alanyl carboxypeptidase to synthesise the cell wall. The presence of β-lactam rings competitively inhibits the enzymes by binding to their active site. Thus inhibiting cell wall synthesis which stops cell division and causes lysis due to fragility of cell wall and high osmotic pressures. Aeromonas spp. contain the genetic information that codes for the synthesis of Beta-Lactamase an enzyme which inactivates the β-lactam ring via hydrolysis causing a resistance to…
Between the Living and The Dead Case Study Some differences between a bacteriophage and a bacterium are that bacterium is longer than bacteriophage, some bacterium have more of a negative affect than bacteriophage on humans, bacteriophage is non-living and the bacterium is living. The bacteriophage in the text is the T-4 bacteriophage which is 200nm in length and 80-100nm wide. The bacterium in the text is the E. coli (Escherichia coli) which is 3000nm in length, which is significantly bigger…
In the three years that have passed since I earned my undergraduate degree, much has changed in my life. For a year and half, I moved to West Virginia to work with an intracellular human pathogen, Chlamydia trachomatis, that has caused a serious public-health problem. In afterward, I transitioned to Maryland where I am currently working as an Intramural Research Training Award postbaccalaureate (IRTA) research fellow at the National Institute of Health (NIH) investigating against the common…
NK-cells (natural killers) represent a heterogeneous lymphocytes population of innate immune system. They have a natural cytolytic activity, are capable of producing cytokines and chemokines and are involved in the antiviral and antitumor body control. In the quiescent state, an average diameter of NK-cell is about 8.7 microns, while in the moment of its activation it may increase its size up to 10-12 microns (Ferlazzo et al., 2004). This feature was the reason for the initial determination of…
(Tophaceous gout in the finger pads). Gout is also associated with hypertension, obesity, dyslipidemia, diabetes mellitus and insulin resistance (Multiple asymptomatic nodules in middle-aged (Rheum book chap 188). Rare causes of hyperuricemia include tumor lysis syndrome, genetic conditions such as Lesch Nyhan syndrome, or malnutrition (Tophaceous gout in the finger…
the full media plate. The media type that the seeds were grown on was the independent variable in the experiment while the dependent variable was the different levels of miRNA expression. The plants were then collected into a tube and grinded in a lysis mix with a pestle. To isolate the small RNAs, the Sigma mirPremier miRNA isolation kit was used. Reverse Transcriptase Master Mix was then used for the reverse transcription reactions by putting the miRNAs in a thermocycler to convert them into…
mainly due to the prior treatments lack of success at removing a significant portion of cancerous cells, allowing the left-over cells to continue to proliferate and appear to be almost resistant to drugs that are designed to initiate apoptosis or cell lysis. Not only that, the remaining treatment options may not be appropriate for an ill child because they are riskier (stem cell transplant has a low success rate) leading to death. Thus, this would increase the mortality rate of children…
the bacterial cell, its active ingredient is sodium hypochlorite. The final antimicrobial agent is Envirocide which has the active ingredient of isopropanol whose mechanism of action is causing membrane damage, destruction of cellular metabolism and lysis of the…