Risk management is considered to be important to control the level of risk and to lessen the effects and has become the major element of an organization activity. This is to ensure the organizational activities can take place smoothly and the organizational objective can be reached efficiently. Referring to research conducted in, a conceptual model has been developed which describes the generic approach of risk assessment and outline the gaps in the assessment steps. Besides, a comprehensive…
The LUCIFER EFFECT Richard Williams University of Central Arkansas The LUCIFER EFFECT Take a deep breath, then exhale, and now ask yourself this question: “Are you, your family members, your friends, the people you work with, or the good person sitting beside you exempt from doing acts of evil or becoming evil?” When polling my friends and family most answered rapidly with: “Of course I am not evil,” “I have morals and go to church,” “I’ve known my family forever….nobody in my immediate…
The Maya used their advanced knowledge in mathematics to invent the most accurate calendar system in ancient times. The Maya had a clever mathematical system that was very useful for many of their calculations. "They used a mathematical system based on the number 20. Their use of place notation and their invention of the zero allowed them to make immense calculations, sometimes involving millions. Their mathematical abilities in turn allowed them to make the calculations necessary for their…
With the landmark figures like Martin Luther King Jr. and cases such as Brown vs. Board of Education, Americans tend to consider segregation as a relic of a past and shameful age. In reality, the passage of the Civil Rights Act simply halted de jure discrimination (segregation imposed by the government), but de facto segregation (segregation without a legal requirement) still exists. American views of race and religion have systemically disenfranchised minorities. Look no further than the…
“The way of the Shaman: a guide to power and healing” In The Way of the Shaman, Michael Harner tells his story of his experiences while he searches to understand the philosophy of shamanism. His story is presented in his book in which he shares his interactions with indigenous people from the upper Amazon forest of South America as well as to western North America and Mexico. Harner takes the reader along on his shamanic journey of enlightenment. This section contains a summary of The way of…
trivial to produce the correct distance travelled than our expectations. The original wheel diameter may differ from the nominal wheel diameter. Though, RTK- GPS provides accurate position, it is very expensive in real world applications [2]. The inner surface and outer surface of the wheel travel ate different distances.A feed-forward controller can be used in designing the tracking algorithms. A controller can be used to control the steering…
Why to use Welch Allyn otoscope? Description: Different advanced features have been included within Welch Allyn otoscope and thus the device is quite unique. Ear abnormalities can now be easily detected with ease by this updated otoscope. Welch Allyn otoscope is currently replacing the usage of traditional devices for ear examinations. You can now collect necessary info about the device directly from the available online reviews on this product. You can also have a look at the product manual…
different sets of LAMP primers were designed based on this specific SCAR derived RAPD marker sequence of M. eumusae and screened for the production of LAMP products (Fig. 1). Out of nine sets of primer screened, only one set of forward and backward inner primers viz., FIP1L-GTCTGGAAGCACGCCAATCTGT-TACTTGAAGGCATGCACCAC and BIP1L- TTCGCAACCTCATCGACGTTGT-TCCAGTACTCATTGGCCTCC along with outer primers F3- GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3)…
In The Sound and the Fury, the myth of the Southern Belle is central to understanding the mental crisis Compson brothers experience that hinders their engagement with reality. In The Sound and the Fury, the Compsons, a disintegrating Southern aristocratic family mentally still living in the Old South, struggle with changing South and its conditions. In the novel, their only daughter Caddy’s virginity is a metaphor for the Old South; the role of the Southern belle is the role that Caddy is…
“verily mine struggle is most evident”. The general attitude towards women in medieval times was that they were inferior to men. Generally, women were taught that they should be meek and obedient to their fathers and husbands. (Schaus). There is a loop hole to this teaching, however. If a woman was unmarried, she had power and could hold land just as men did. (Schaus). When…