Gel electrophoresis

Each tubes were incubated for 60 minutes in a 37oC water bath to guarantee cleavage of DNA. Eventually, 5 µl of 10x gel loading solution was added to each reaction in order to stop the reactions. Then each solutions was mixed again then soon placed in heated bath for two minutes, eventually added to the electrophoresis gel for about 60 minutes. The .8% agarose gel used for electrophoresis aided in slowing the migration of the DNA fragments since large DNA fragments migrate faster than expected…

GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color. The LAMP amplified products also produced a ladder-like pattern in the gel electrophoresis. This indicated the amplification of target pathogen M. eumusae by the designed LAMP primers (Fig. 2). Optimization of LAMP reaction During the LAMP optimization process, the effects of Mg2+ concentration, the amount of…

In gel electrophoresis, a dye is added to DNA samples to be able to see the DNA. The DNA is then placed in a clear, semi-porous gel submerged in a chemically neutral solution, and an electric current is run through the gel. Since DNA has a slight negative charge, it will be attracted to the positive side of the gel. Consequently, the DNA fragments will move through the gel. However, the DNA fragments do not all move at the same speed. The gel is only semi-porous, so it slows…

corn DNA contained the GMO DNA, the GMO primers were able to anneal to the correct segment, and as the PCR cycles continued, the DNA was amplified. Since the PCR produced millions of copies of the fragment DNA, they produced visible bands when electrophoresis was completed. This band did not occur in the lane with the non-GMO barley with GMO primers because the primers were not able to anneal to a DNA segment and initiate the replication. This is because the GMO primers can only attach to GMO…

position of the restriction enzyme cut on the DNA sequence and what the size of the DNA fragment is. In week two the DNA sequences of the wild type and mutant were exposed to restriction enzymes and then agarose gel electrophoresis. The students prepared six tubes for the agarose gel. All of the pipetting was done with a P20 pipette. The controlled factors of this experiment were the amounts pipetted and the chosen restriction enzyme BsrG1. Tube A and Tube B were the negative controls, Tube…

and there is no migration in or out of the population. In this experiment, the Hardy Weinberg equation will be applied to the class Alu genotype results to determine if the class population is in equilibrium. Cheek cell swabbing, PCR, and gel electrophoresis will all be done in order to find out if the student is homozygous dominant, heterozygous, or homozygous recessive for the Alu insert. The results from all of the individual tests done in the class will not be indicative of Hardy-Weinberg…

performing a DNA extraction and purifying your template. The purification will be done in a QIAquick column and it will remove dNTPs and primers from your PCR reactions that created your amplicon. Determine the quality of your DNA by running a gel- electrophoresis and a Spectrophotometry of your sample. The thermos cycler begins the reaction by heating the two DNA strands to 90 Celsius in order to separate them. Then the primer anneals to the sequence at a lower temperature of 54 Celsius. Then…

Maple Syrup Urine Disease Hannah Gentry , 13SK , 8/21/2014 Maple syrup urine disease (MSUD) is a rare genetic disorder where an aminoacidopathy secondary to an enzyme defect in the catabolic pathway of the branched-chain alpha-keto acid dehydrogenase complex, which are required in order to metabolize certain amino acids in the human body. In other words, it is a metabolism disorder, where the infant is unable to break down the amino acids: leucine, isoleucine, and valine. Build up of these…

pKN800 plasmid DNA. The plasmid was purified and isolated, then cut with PstI restriction enzyme to create a sample of PstI-cut and uncut pKN800 plasmid DNA and to distinguish orientation A from B. These samples were loaded onto a 0.8% agarose gel for electrophoresis. Both cut and uncut plasmid DNA were transformed into E. coli DH5α. Finally, the transformed DNA was plated on LB and LB with ampicillin agar plates. The procedure for this experiment was followed on pg. 16-23 of the MB 311…

Polymerase Chain Reaction & procedure. 8. Result analysis using Gel Electrophoresis. 9. Statistical data analysis 1) Sampling: Extracted human teeth were obtained from the Department of Oral and Maxillofacial Surgery, Vyas Dental College & Hospital. The present study was conducted by grouping the samples subjected to various environmental conditions and into Control. Study Group I. Freshly…