Biotechnology

world population is said to grow 50% in the next few decades. This means that the human population must find a way to double food production in the next 20-30 years, or hunger will worsen significantly. Biotechnology and genetically modified organisms might have the answer. Now, can biotechnology alone cure world hunger—no, but genetically modified organisms might be able to help significantly. Some people protest that it might not be the “healthiest” option; thus, a cost-benefit-analysis should…

their organic counterparts, so that the labeling of them in unnecessary, but the facts seem to sing a different song. Genetically modifying foods has been praised for the impressive number of crops the practice yields with the use of “harmless” biotechnology. But as you will soon discover, GMOs are anything but harmless. Although it may appear beneficial to some, America should not continue production of genetically modified crops and livestock because of the negative effects…

Genetically modified organisms, better known as GMOs, have been a controversial topic that has caused an uproar among the population. The researcher’s interest pertaining to this topic was peaked approximately one year ago during a biotechnology lecture. Throughout this lecture Mrs. Rausch, a former biotechnologist, explained the fundamental concepts and processes of making genetically modified organisms. Not only has this lecture shaped the researcher’s bias, but his extensive research for…

Works Cited Feng, Ling, et al. “Competing for Attention in Social Media under Information Overload Conditions.” National Center for Biotechnology Center, Journal Pone, 10 Jul. 2015, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4498816/ Biolystok, Ellen, et al. “Bilingualism: Consequences for Mind and Brain.” National Center for Biotechnology Center, Elsevier, 30 Mar. 2012, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3322418/ Early Childhood Learning and Knowledge Center. “The Benefits…

(MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5…

foods. The United States does not regulate these crops, while Europe prefers that alien genes are not found in their food. Meanwhile, Africa turned down corn from the United States because it was genetically modified. President Bush believed that biotechnology could be a solution to the food problem on the African continent. The British are very careful about genetically modified products due to the mad cow disease epidemic. Some examples of these foods include flour, taco shells, corn flakes,…

has been modified using direct manipulation or biotechnology. This technology includes the changing of the genetic makeup of cells including the transfer of genes within and across species boundaries to produce an improved or novel organism. Genetic engineering can also be used to remove genetic material from a target organism. Genetic engineering techniques have been used in several fields including research, agriculture, industrial biotechnology and medicine. Plants, animals or…

food; however, are we actually consuming natural foods? We are not sure about these questions because we do not know what ingredients inside the food we eat are. Currently, a lot of food has already changed taste, appearance and nutrition due to biotechnology, and more and more genetically modified food (GM food) is available on the market without specific markers. At the same time, the widespread use of GM food is becoming controversial. Although GM food has better…

prompters. This permanently changes the genetic code of that organism. This technology, for the first time in history, allows biotechnology corporations to become the architects and “owners” of life. This technology eliminates the need for farmers to use breeding methods to weed out traits and proteins that are unwanted in the plant or animal (Miller 12). With this bypass biotechnology companies can precisely evolve the DNA to produce the traits that they need. According to the World Health…

Many citizen petitions have submitted a claim to either ban the use of “natural” or to redefine it in a way that the overall consumer population can understand clearly what exactly “natural” really means. On the other hand, the private food corporation has also requested an establishment regarding the concern of foods that include corn syrup being recognized as “natural.” FDA’s definition of the term “natural” has been unclear for decades. This has resulted in many of the food industries to…