Biochemistry

I am standing in the ICU about to make rounds with the medical team on my first day shadowing a clinical dietitian. I had already been working in the hospital first as hospitality and then as a diet clerk so I was experienced with the foodservice side of things but I was very excited to experience a day in the life of a clinical dietitian. As I move from patient to patient, I see the integral role that the dietitian plays in the healthcare team and the relationship to my diet clerk…

always inspired me to work towards achieving the goals I set and define the research experiences I had at University of California, Los Angeles (UCLA). Having specialized in biochemistry, I grew and developed a unique zeal and anxiety to deeply understand the nature of protein and its molecular composition. My interest in biochemistry lead me to join…

They include many hormones, alkaloids, and vitamins. Steroids are in the lipid family. Anabolic steroid research would fall under biochemistry and organic chemistry, as biochemistry is the study of processes within living things, and organic chemistry overlaps many areas of biochemistry. Steroids are found predominantly in eukaryotic cells, with cholesterol being the most prominent steroid molecule. Steroids at their core are simply carbon atoms bonding together…

Kurt Vonnegut was an inspiring and impactful writer. He wrote many novels, short stories, and poems. Kurt Vonnegut received many awards for his stellar writing. He usually wrote his stories in the styles of drama, fiction, and science fiction. Kurt Vonnegut wrote because he enjoyed writing and because it helped him cope with whatever was going on in his life at the moment. This is what made Kurt Vonnegut such a great writer. Kurt Vonnegut was born on November 11, 1922 in Indianapolis, Indiana.…

Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX,…

qualitatively define the components in the products, documenting the processes and results as the research was actively conducted. I am currently interested in developing my knowledge and research abilities in the fields of Virology, Gene Therapy, Biochemistry, Molecular and Cellular Biology, Microbiology, and Immunology. My primary area of interest lies within the study of microorganisms and their ability to cause devastating illness in Eukaryotic organisms. In my academic career, I have…

Disease and infection are an inevitable part of being human, but also an intriguing part. I first became aware of the possibilities of studying microbiology when I attended a lecture on “Microbiology and Bioterrorism” at the Medlink Conference at Nottingham University in 2014. I found this lecture really interesting, and left the Conference wanting to know more about microbiology. Studying Biology at A2 has led me to realise the incredible impact that microorganisms have on every aspect of our…

Endosymbiotic theory states that organelles were once prokaryotic cells, living as a part larger cells. The prokaryotic cells may initially have been parasites or an intended meal for the cell. Whatever the cause, those prokaryotes would soon become cooperative prisoners. The prokaryotic cells would soon provide crucial nutrients or even to maximize oxygen usage for transforming energy. The prokaryotic cells, in return, would get protection and a constant environment to live. A lot of evidence…

To be a Forensic Scientist you will need a degree in either a scientific or biological subject, chemistry, or forensic science. A degree in statistics and geology also is very helpful for the job. Since there is such a competition for the job, getting a MSc or PhD in forensic science is very helpful also, anthropology and archaeology can also be very beneficial. The best colleges to go to for this career would be, University of Mississippi in Oxford, University of Central Florida, and Loyola…

sputum, fever, chest pain, breathlessness and others. 5. When one develop these symptoms we should go for check up to the specialist. The investigation which are commonly done are sputum examination, chest X-ray, culture test of blood and sputum, biochemistry and hematological profile. All these are done to find out the extent of pneumonia and possible germs causing it. Nature of the germs are different according to the different scenario of disease development like, community acquired…