Agarose gel electrophoresis

presentation of various types of cancer in a family. This experiment was conducted to determine first, based on Valerie’s family pedigree, if Li-Fraumeni syndrome is present in her family and who has been affected by it. Once this was established, gel electrophoresis was used to compare samples of Valerie’s blood and normal breast tissue to her tumor tissue and to a wild type DNA fragment to see whether or not her cancer has metastasized; it did not appear that this was the case. Lastly, her…

Identifying an Unknown Plasmid Through the Process of Gel Electrophoresis Introduction: Biotechnology requires certain techniques and methods that help identify plasmids, which can be used for forensics, DNA fingerprinting, etc. In this class, each lab focused on teaching the process of using the correct techniques used to identify a plasmid. Plasmids are pieces of DNA that are circular and relatively smaller than chromosomes. They aren’t important in the sense that they don’t carry out…

a little bit of bubbles, but we tried to get rid of it by pipetting it out of the tube which was a big error. Doing that, made us not have enough master mix later on to add it to our extracted DNA and the negative control tube so when we looked at out gel under the light, we had no bands for negative…

Scientific experiments and observations have led to many discoveries, which in turn have allowed scientists to develop a better understanding on the way diseases originate in humans. Molecular biology in particular has allowed scientists to discover the way in which domains, found in proteins impact a genome. Domains are autonomous folding units that carry out specific functions and mechanisms in a certain protein. These functions consist of being responsible for interactions in the cell, which…

molecular techniques important for biologists to understand. In this portion of the lab, the chromosomal DNA (chDNA) will be isolated. Its purity will be measured using spectrophotometric analysis. Lastly, the DNA will be digested and verified via gel electrophoresis. A. fischeri is a gram negative rod shaped marine bacteria that exhibits bioluminescence and is both found free-living or in symbiosis. It has a variety of hosts such as the bobtail squid and is named after the German scientist…

from PCR, students used Gel Electrophoresis to separate electrically charged molecules. Gel Electrophoresis requires 3 steps; preparing a gel solution, gel electrophoresis, and photographing the gel. To prepare the gel, students mixed .3g of agarose and 30mLs of 1X TAE buffer in a 125 ml flask (Penn State Biology 220W Lab Manual, pgs.55-59). The mixture was microwaved and set to cool for 3 minutes. After the cooling process, 1µl of ethidium bromide dye was added to the agarose. The mixture was…

(Biotium) was added, and the solution was poured into a gel casting tray with a 15-lane comb. Once the gel had set, it was placed in the running apparatus (Bio-Rad) and submerged with 1X TAE buffer. DNA samples were prepared for loading by adding 1X DNA loading buffer (Fermentas, Life Technologies, 10mM Tris-HCl (pH7.6), 0.03% bromophenol blue, 0.03% xylene cyanol, 60% glycerol, 60mM EDTA). A 1kb ladder was loaded first followed by the DNA samples. The gel was operated at 100 volts for 30…

GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color. The LAMP amplified products also produced a ladder-like pattern in the gel electrophoresis. This indicated the amplification of target pathogen M. eumusae by the designed LAMP primers (Fig. 2). Optimization of LAMP reaction During the LAMP optimization process, the effects of Mg2+ concentration, the amount of…

For the preparation of TLC plates, 20 x 15 x 5 glass plates were properly washed and coated with silica gel (Merck) of 0.5mm thickness. The coated plates were activated by incubating at 100ºC for 3h prior to use. The sample and positive control (Vinblastine, Sigma, 1mg/ml) were spotted on to activated TLC plate just 1cm above the subordinate edge of plate…

cognitive disorder affecting more than 28 million women in the US alone (Migraine Research Foundation, 2016). To find SNPs, the control and mitochondrial region of DNA was isolated, followed by Polymerase Chain Reaction (PCR) amplification and gel electrophoresis to see the isolated DNA. For the PCR segment, base pair (bp) approximations of 500 (Figure 1) and 1100 were found for PCR Products A and B respectively. RFLP did not result in significant sites which provide suitable evidence of SNPs.…