Structures And Functions Of Nucleotides Exam 2 - Hughes

Front 1

List two reasons (benefits) for making a chemical analog for oligonucleotides?

Back 1

(Two of the three)
1. Increased metabolic resistance
2. Increased binding with target
3. Better cellular uptake

Front 2

List two disadvantages which can arise from making chemical analogs to oligonucleotides?

Back 2

(Two of the four)
1. Decreased binding affinity
2. Loss of RNase H activity
3. Increased non-specific side effect (cytokine production)
4. Activation of complement pathway

Front 3

Based on the structure of the nucleotide, would it be most likely used as a starting point for a siRNA molecule or an antisense oligonucleotide?

Back 3

siRNA molecule

Front 4

Complete the sentence for the RNA interference pathway in cells:
Viral dsRNA is converted by ____________ into siRNA. siRNA then interact with ____________ forming an enzyme-nucleic acid complex.

Back 4

Dicer
RISC

Front 5

Provide one reason why ocular diseases are more attractive than a systemic disease for oligonucleotide therapy.

Back 5

(One of the three)
1. Easy to administer
2. Closed compartment limits side effects
3. Closed compartment (can get high local concentration)

Front 6

Give an example of an ocular disease that we discussed in class for treatment with Antisense DNA oligonucleotides or siRNA?

Back 6

Antisense DNA oligonucleotides: CMV Retinitis
siRNA: Macular degeneration

Front 7

The following mRNA sequence is part of the total sequence coding for a pathogenic protein
5' AUGCGAAACATCGCGCG 3'
Give the sequence for the shortest possible oligonucleotide sequence that would form the most stable hybrid at body temperature (37 C)

Back 7

5' CGCGCG 3'

Front 8

The following mRNA sequence is part of the total sequence coding for a pathogenic protein
5' AUGCGAAACATCGCGCG 3'
If we changed the above oligonucleotide from a phosphodiester to a phosphorothioate backbone oligonucleotide would the affinity increase, decrease or remain the same and why?

Back 8

Decrease
Sulfur is bigger and has more diffuse electron density

Front 9

The following mRNA sequence is part of the total sequence coding for a pathogenic protein
5' AUGCGAAACATCGCGCG 3'
If we changed the above oligonucleotide from a phosphodiester to a methylphosphonate backbone oligonucleotide would the affinity increase, decrease or remain the same and why?

Back 9

Increase
Methylphosphonate is not changed

Front 10

The three oligonucleotides were designed to different regions of a particular mRNA. All the sequences are 100% complementary to a portion of mRNA. The Tm indicates how strong the interaction is between the mRNA and oligonucleotide. The higher the Tm the greater the interaction. Please provide a rationale for the sequence and the Tm's relationship.
Oligo A 5' ATACGATACGACG 3' Tm C: 42
Oligo B 5' GACTACATACGA 3' Tm C: 38
Oligo C 5' GCAGGCATACCGT 3' Tm C: 40
Why is A>B?

Back 10

A is longer or greater number of G:C pairs

Front 11

The three oligonucleotides were designed to different regions of a particular mRNA. All the sequences are 100% complementary to a portion of mRNA. The Tm indicates how strong the interaction is between the mRNA and oligonucleotide. The higher the Tm the greater the interaction. Please provide a rationale for the sequence and the Tm's relationship.
Oligo A 5' ATACGATACGACG 3' Tm C: 42
Oligo B 5' GACTACATACGA 3' Tm C: 38
Oligo C 5' GCAGGCATACCGT 3' Tm C: 40
Why is C>B?

Back 11

Shape of mRNA must limit interaction

Front 12

The three oligonucleotides were designed to different regions of a particular mRNA. All the sequences are 100% complementary to a portion of mRNA. The Tm indicates how strong the interaction is between the mRNA and oligonucleotide. The higher the Tm the greater the interaction. Please provide a rationale for the sequence and the Tm's relationship.
Oligo A 5' ATACGATACGACG 3' Tm C: 42
Oligo B 5' GACTACATACGA 3' Tm C: 38
Oligo C 5' GCAGGCATACCGT 3' Tm C: 40
Why is A>C?

Back 12

G:C content greater for C

Front 13

Which of the following statements is true?
a. ODN are double stranded while siRNA are single stranded
b. ODN hybridize via hydrogen bonds while siRNA molecules interact through ionic bonds
c. Phosphate bonds occur in ODN but not siRNA
d. The molecular weight of ODN is less than the molecular weight of siRNA
e. Chemical analogs can increase the stability of both siRNA and ODN

Back 13

d. The molecular weight of ODN is less than the molecular weight of siRNA

Front 14

What is the hydrogen bonding type between Antisense Oligonucleotide and its target mRNA?
a. Electrostatic hydrogen bonding
b. Watson-Crick base
c. Hoogsteen
d. Reverse Hoogsteen
e. Aptameric Hydrogen Bonding

Back 14

b. Watson-Crick base

Front 15

Which of the following mechanisms can explain the translational arrest observed with Antisense ODN?
a. Ribosome movement blocked
b. Activation of 3' exonuclease
c. Inhibition of mRNA transport from the nucleus
d. DNA nucleases degrading the target
e. Through the controlled pore glass pathway

Back 15

a. Ribosome movement blocked

Front 16

List three important considerations in the design of Antisense Oligonucleotides.

Back 16

1. Length
2. Target (quantitative or qualitative)
3. Sequence (where on mRNA to target or sequence of ODN)

Front 17

Explain why the theoreticaly optimal length of antisense oligonucleotides is a 12 mer for the cellular RNA pool as compared to 16 mer for the human genome.

Back 17

The cellular RNA pool is shorter since the introns have been removed.

Front 18

What is a major limitation to the use of Peptide Nucleic Acids as compared to ODN?

Back 18

The uncharged backbone decreases their water solubility

Front 19

What are the two major groups of nucleases that can degrade oligonucleotides?

Back 19

Exonucleases
Endonucleases
(or DNAse or RNAse)

Front 20

Which type of nuclease is the major reason phosphodiester oligonucleotides degrade in the plasma?

Back 20

Exonuclease or 3' Exonuclease

Front 21

List two distinct approaches to increasing the stability of phosphorodiester from metabolic degradation.

Back 21

1. Chemical analog (backbone modification, sugar modification, capping)
2. Formulations (cationic, liposome or surfactants)

Front 22

In a nucleotside attached to a control pore glass (CPG) bead as a starting point for the synthesis of the oligonucleotide, what is the major advantage arising from the use of a CPG class bead?

Back 22

Aid in purification

Front 23

List two major advantages of antisense oligonucleotides over traditional drug therapeutics.

Back 23

)Two of the three)
1. Easier to design than traditional drug
2. More potent
3. More selective

Front 24

Oligo: Antigene
Target: ______________
Type of Hydrogen bond between ODN and Target: ______________

Back 24

DNA
Hoogsteen

Front 25

Oligo: ______________
Target: ______________
Type of Hydrogen bond between ODN and Target: Watson Crick Base Pairing

Back 25

Antisense
RNA

Front 26

Oligo: ______________
Target: Protein
Type of Hydrogen bond between ODN and Target: ______________

Back 26

Aptamer
Hydrogen bond

Front 27

What are the two proposed mechanisms of action for Antisense deoxyoligonucleotides?

Back 27

1. Activation of RNAse
2. Translation arrest (ribosome blockade)

Front 28

In class several chemical analogs of oligonucleotides were discussed. Please list two of these analogs and describe a positive and negative consequence from the chemical alteration of the normal phosphodiester oligonucleotidess.

Back 28

(Two of the following)
Phosphorothioate backbone: Increased resistance to nucleases but Decreased binding
Methylphosphonate or PNA: Increased restistance to nucleases and Increased target interaction but Loss of RNase H
Sugar modifications: Increased resistance to nucleases but Loss of RNase H

Front 29

Most oligonucleotides have their site of action within the cell. What mechanism is most likely involved in their intracellular transport?

Back 29

Endocytosis

Front 30

List one method that could be used to increase the intracellular transport of oligonucleotides

Back 30

Catonic surfactants or liposomes

Front 31

Complete the following sentence which relates to cellular response to a double stranded RNA virus:
1. Entry of a virus into cell and release of RNA 2. _____________ (enzyme) degrades viral RNA into siRNA 3. siRNA combines with ribonuclease creating _____________ 4. Target RNA degraded

Back 31

Dicer
RISC

Front 32

Would you consider antisense targeting of HIV mRNA a qualitative or quantitative target?

Back 32

Qualitative

Front 33

What are 2 advantages of targeting mRNA over a protein for the treatment of HIV infection?

Back 33

(Two of the following)
1. More specific
2. More potent
3. Intervenes at an easier step
4. Easier to design

Front 34

What type of hydrogen bonding occurs between an antisense oligonucleotide and its target mRNA?

Back 34

Watson-Crick base

Front 35

In the abstract the following statement is made "then we could stop this mRNA interacting properly with the ribosomes and stop the production of the protein encoded by the mRNA". List two possible mechanisms for stopping the production of the protein.

Back 35

1. Activation of RNase H
2. Translation arrest (blockade of ribosome)

Front 36

Most oligonucleotides are produced with the aid of CPG (control pore glass) bead. What is the major advantage for using this bead in the synthesis of oligonucleotides?

Back 36

Makes purification easier

Front 37

In the abstract, this statement is made "They are stretches between 2-20 nucleotides devised to be complementary to a specific type of mRNA". This statement implies there is a rationale of a specific length of oligonucleotides to be used as a therapeutic agent. List two reasons for using oligonucleotides longer than 2 bases as a therapy for HIV.

Back 37

To form a stable hybrid (longer than 6)
To be selective (16 or longer)

Front 38

In the abstract the following statement is made "Also, antisense oligonucleotides are readily degraded by enzymes found throughout the human body." What type of DNase (be specific) is responsible for metabolism of antisense oligonucleotides in the blood?

Back 38

3' exonuclease

Front 39

Given the metabolic instability of phosphodiester oligonucleotides medicinal chemistry have produced chemical analogs to increase their stability. Identify two separate families of modifications which have been made to oligonucleotides to increase stability and give an example.
Site of modification and example

Back 39

Backbone - Methylphosphonate, PNA or Phosphorthiolate
Sugar - 2'-modification

Front 40

The introduction of chemical modifications to increase stability often has undesired effects on the activity of the oligonucleotides. List two modifications (analogs) and a specific undesired effect for that modification.
Oligo modification and Site of Undesired Effect?

Back 40

Oligo modifications 2' sugar, Methylphosphonate, PNA
Undesired Effects (For all): Loss of RNase H
Oligo modifications Phosphotionate
Undesired Effects: Loss of binding

Front 41

Which of the following correctly describes the molecular events of RNAi?
a. Dicer degrades double stranded DNA into siRNA which causes degradation of mRNA
b. Dicer degrades double stranded RNA into siRNA which then results in the degradation of mRNA
c. siRNA is converted into double stranded RNA which results in reduced transcription of specific genes
d. Dicer degrades double stranded RNA into siRNA which reduces transcription of specific genes
e. Dicer degrades mRNA which then enables double stranded RNA to be degraded into siRNA

Back 41

b. Dicer degrades double stranded RNA into siRNA which then results in the degradation of mRNA

Front 42

Which o the following statements are TRUE?
a. Ribozymes possess catalytic activity
b. Peptide nucleic acid based Antisense oligonucleotides possess catalytic activity
c. Ribozymes works with endogenous enzymes to cleave the target RNA
d. Antisense oligonucleotides can work with endogenous enzymes to cleave the target RNA
e. A and D

Back 42

e. A and D

Front 43

Which of the following statements correctly describe the central dogma of molecular biology?
a. RNA makes DNA makes proteins
b. RNA makes cDNA makes proteins
c. DNA makes RNA makes proteins
d. Protein makes pre-mRNA makes RNA
e. Reverse transcriptase makes RNA makes protein

Back 43

c. DNA makes RNA makes proteins

Front 44

Which of the following modification to DNA may result in inactivation of gene expression?
a. Polyadenylation
b. Methylation
c. Phosphorylation
d. Glycosylation
e. Phosphothioate backbone

Back 44

b. Methylation

Front 45

The breakthrough of 2002 as reported in Science was the incredible potential of siRNA. Which of the following functions can be associated with siRNA use?
a. siRNA is able to down-regulate gene expression
b. siRNA is able to stimulate gene expression
c. the mechanism by which siRNA works is similar to RNAi
d. A and C
e. B and C

Back 45

d. A and C

Front 46

Describe or list three major advantages that oligonucleotides have over traditional drugs.

Back 46

1. Traditional drugs intervene after disease-causing protein formed
2. Antisense blocks mRNA translation before protein synthesis
3. Targets one mRNA so more specific and fewer side effects

Front 47

Oligonucleotides can be classified according to their intended target they interact. List three types of oligonucleotides, identify their target and list the type of bonding they have with their targets.

Back 47

Oligo: Antisense
Target: mRNA translation
Type of Bonding: Watson-Crick
Oligo: Antigene
Target: DNA transcription
Type of Bonding: Hoogsteen or reverse Hoogsteen
Oligo: Aptamer
Target: Protein
Type of Bonding: Hydrogen bond

Front 48

Antisense deoxyoligonucleotides have two proposed mechanisms of action. What are these two mechanisms of action? Which mechanism do you think might be more important and why?

Back 48

1. Activation of RNase H
2. Translation arrest
The more important one and why? Activation of RNase H because after degradation of RNA, DNA can bind to another piece of RNA

Front 49

What is the major limitation of using phosphodiester oligonucleotides as a therapeutic drug?

Back 49

Poor stability

Front 50

Phosphorothioates and methylphosphonates are analogs of phosphodiester oligonucleotides that are used for therapeutic purposes.
What part of the oligonucleotide is modified in these analogs?

Back 50

The phosphate (phosphorous) backbone

Front 51

Phosphorothioates and methylphosphonates are analogs of phosphodiester oligonucleotides that are used for therapeutic purposes.
What is one advantage to making the analogs?

Back 51

More stable

Front 52

Phosphorothioates and methylphosphonates are analogs of phosphodiester oligonucleotides that are used for therapeutic purposes.
What is one disadvantage to making the analog?

Back 52

Binds less tightly

Front 53

You have been asked to design an oligonucleotide for a therapeutic agent, below is the 3 regions of mRNA for you to consider for the oligonucleotide. Affinity is not a problem for selection.
5' AUUUCGCAUCAGGAACUCCCGAAAUUU 3'
5' AAUCGGGAAUUCGCGCAUAUGAAAA 3'
5' AUUCGAUGCGCUUAAACGCUAAUCG 3'
Which oligonucleotide would you choose and why and then design a sequence to interact with the oligonucleotide?

Back 53

Third oligonucleotide because more C:G pairs and has start codon
3' TAAGCGTA... 5'

Front 54

The company wants to use a hybrid/chimera for therapy. What are 2 reasons for the selection of this type of oligonucleotide?

Back 54

Phosphodiester part binds well while hybrid part with phosphothioate linkage is stable to degrading enzyme.

Front 55

Which statement is false in terms of oligonucleotide synthesis?
a. The reaction, oligonucleotide synthesis is initiated on CPG (controlled pore glass)
b. Consists of a cycle of conjugation followed by deprotection
c. Is efficient when the oligonucleotide is fairly small in length
d. Is a solution phase homogenous chemical reaction
e. Can be used for both phosphodiester and phosphorothioate oligonucleotides

Back 55

d. Is a solution phase homogenous chemical reaction

Front 56

List three potential advantages of oligonucleotides over traditional drugs?

Back 56

(Any three)
Selection
Ease of design
Potency (more effective)
Fewer side effects

Front 57

There are three general types of oligonucleotides as classified by their site of action. List the oligonucleotide type, Target of oligonucleotide and Rank the potency (rank from from highest 1 to lowest 3)

Back 57

Oligonucleotide type: Antigene/Triplex
Target of oligonucleotide: DNA
Rank the potency: 1
Oligonucleotide type: Antisense
Target of oligonucleotide: mRNA
Rank the potency: 2
Oligonucleotide type: Aptamer
Target of oligonucleotide: Protein
Rank the potency: 3

Front 58

Phosphorodiester antisense oligonucleotides have two major mechanisms of action. Briefly explain these mechanisms.

Back 58

1. Activation of RNase H
Cleaves the mRNA portion of a DNA/RNA hybrid thus freeing the oligonucleotide to hybridize to additional mRNA molecules
2. Translation Arrest
The oligo-DNA/RNA hybrid stops the ribozyme from processing the mRNA into a protein

Front 59

One type of analog of antisense oligonucleotides includes a 2-5' poly A section. What enzyme does this addition activate?

Back 59

RNase L

Front 60

Several items can impact the choices of a particular oligonucleotide sequence. One of these factors is the length of the oligonucleotide. Below give one reason why there is a minimal length needed for interaction with the mRNA. In additional give a reason why not to use very long oligonucleotides for antisense activity.

Back 60

1. Minimal length
To be able to form a stable duplex at 37 C or To be specifically hybridized
2. Maximum length
Hard to synthesis very long oligonucleotides or oligonucleotides can fold back and hybridize to self or can bind to multiple regions of RNA losing specificity

Front 61

List three potential disadvantages of the use of oligonucleotides and a method to overcome this disadvantage.

Back 61

1. Problem: Cellular uptake, Oligonucleotides are high molecular weight polymers
Solution: Complex with catonic surfactants or attach cholesterol or ligand to increase uptake
2. Problem: Metabolic instability
Solution: Make analogs to increase stability
3. Problem: Nonspecific side effects (activation of complement or clotting factors)
Solution: Make chimeras phosphodiester-phosphothioate hyrbidize

Front 62

What is one advantage and one disadvantage to using methylphosphonate oligonucleotides as compared to phosphorthioate oligonucleotides?

Back 62

Advantage: Higher binding affinity
Disadvantage: Poor water solubility or does not activate RNase H

Front 63

List three cellular barriers which limit the activity of oligonucleotides?

Back 63

1. Cell membrane
2. Endosome membrane or metabolic degradation in lysosome
3. Exocytosis

Front 64

What is the only disease which currently has an oligonucleotide approved for use?

Back 64

CMV rentintis

Front 65

If methylphosphonate oligonucleotides were used to inhibit the action of a pathogenic protein at what step would inhibition have the greatest effect?

Back 65

Transcription

Front 66

What are two major mechanisms of action proposed for phosphorothioate antisense oligonucleotides?

Back 66

1. Blockade of ribozome
2. Activation of RNase H

Front 67

What is the advantage of adding the 2-5A molecule onto an oligonucleotide?

Back 67

Activation of RNase L

Front 68

Various factors influence the length of the oligonucleotide. If you pick a sequence based on genomic DNA, it was always longer than the same sequence based on mRNA levels. Please give an explanation for this phenomenon.

Back 68

DNA will have introns

Front 69

What are three major limitations to oligonucleotides.

Back 69

a. Stability
b. Cellular permeabilty
c. Nonspecifc effect

Front 70

A pharmaceutical company has asked you for help in evaluating oligonucleotides to develop potential drugs. They have asked you to pick the sequence with the greatest affinity to the following mRNA strand.
5' AUG-CGC-AAA-UGC-UUA-TTA-ATT-CCG-CCC 3'
a. Phosphodiester 5' TAA-TAA-GCT-TTT 3'
b. Phosphothioate 5' TAA-TAA-GCT-TTT 3'
c. Phosphodiester 3' CGC-TTT-ACG-AAT 5'
d. Phosphothioate 3' CGC-TTT-ACG-AAT 5'
e. Phosphodiester 3' TTT-ACG-AAT-AAT 5'

Back 70

c. Phosphodiester 3' CGC-TTT-ACG-AAT 5'

Front 71

Give one example of a non-specific side effect of oligonucleotides.

Back 71

Activation or complement or activation of cytokines

Front 72

Explain why there are limited systemic side effects with Vitravene.

Back 72

Administered locally into the eye by injection. The molecule is large and charged and cannot leave until metabolized.