Reading...
Play button
Play button
Use LEFT and RIGHT arrow keys to navigate between flashcards;
Use UP and DOWN arrow keys to flip the card;
H to show hint;
A reads text to speech;
55 Cards in this Set
- Front
- Back
|
benign tumors come from
|
epithelial or connective tissue
|
|
|
carcinomas derive from
|
squamous, glandular, or transitional epithelium
|
|
|
sarcoma derives from
|
soft tissue
|
|
|
hamartoma
|
non-neoplasatic overgrowth of tissue
|
|
|
grade
|
differentiation
|
|
|
extranodal vs. nodal mets
|
extranodal has greater prognostic significance
|
|
|
osteoblastic bone mets
|
radiodense
|
|
|
osteoclastic bone mets
|
radiolucent
|
|
|
actinic keratosis
|
precursor for squamous cell CA
|
|
|
treating H. pylori infection reduces risk of
|
gastric lymphoma and adenocarcinoma
|
|
|
most common type of mutation in cancer
|
point mutation
|
|
|
proto-oncogenes
|
invovled in normal growth and repair
|
|
|
BCL2
|
inhibits apoptosis
|
|
|
BAX
|
apoptosis gene
|
|
|
mismatch repair genes
|
produce proteins that correct errors in nucleotide pairing
|
|
|
nucleotide excision repair pathway
|
excises pyrimidine dimers in UV-light damaged skin
|
|
|
most common cancer due to excessive UV light exposure
|
basal cell CA
|
|
|
most effective host defense against cancer
|
CD8+ cytotoxic T cells
|
|
|
most common anemia in cancer
|
anemia of chronic disease --> normocytic, normochromic
|
|
|
most common cause of death in cancer
|
gram negative sepsis
|
|
|
respiratory acidosis and hypoxemia
|
increase cerebral vessel permeability
this enhances cerebral edema |
|
|
papilledema
|
sign of cerebral edema
|
|
|
how should you treat a patient with head trauma and why
|
hyperventilate to produce respiratory alkalosis
this will cause cerebral vessel constriction and decrease permeability and cerebral edema |
|
|
uncal herniation
|
midbrain hemorrhage
oculomotor nerve palsy myDriasis |
|
|
most common cause of hydrocephalus in the newborn
|
blockage of aqueduct of sylvius
|
|
|
newborn hydrocelphalus
|
ventricles dilate and head circumference increases
|
|
|
hydrocephalus in adults
|
dementia, gait disturbance, urinary incontinence
"wet, whacky, and wobbly" |
|
|
protection of neural tube defects
|
folate levels must be adequate before pregnancy
|
|
|
syringomyelia
|
decreased pain and temp sensation in hands
|
|
|
tuberous sclerosis
|
mental retardation
hamartomas in brain and kidneys |
|
|
coup injuries
|
site of impact
|
|
|
contra-coup injuries
|
opposite site of impact
|
|
|
repeated episodes of hypoglycemia and the brain
|
has same effect on brain as does hypoxic injury
|
|
|
intracerebral hemorrhage
|
complication of HTN
|
|
|
treatment of HTN reduces
|
incidence of stroke by more than 40%
|
|
|
subarachnoid hemorrhage
|
rupture of congenital berry aneurysm
|
|
|
lacunar strokes
|
caused by HTN or DM
|
|
|
most CNS infections are due to
|
sepsis
|
|
|
meningitis and CSF
|
increased CSF protein --> viral, bacterial, and fungal
decreased glucose --> bacterial and fungal |
|
|
oligoclonal bands in CSF electrophoresis
|
sign of demyelination
|
|
|
cause of central pontine myelinolysis
|
rapid IV correction of hyponatremia
|
|
|
increased beta-amyloid in Alzheimer's
|
causes destruction of neurons
|
|
|
atrophy of caudate nucleus
|
huntington's
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAG |
|
|
cystic degeneration of the putamen
|
Wilson's
|
|
|
belly full of scars
|
AIP
|
|
|
most common primary CNS tumor in adults
|
glioblastoma multiforme
|
|
|
childhood brain tumors
|
cystic astrocytoma and medulloblastoma
both in cerebellum |
|
|
menigioma
|
female predominance
psammoma bodies |
|
|
ependymoma
|
4th ventricle in children
cauda equina in adults |
|
|
oligodendroglioma
|
frontal lobe calcification in adults
|
|
|
primary CNS lymphoma
|
occurs in AIDS
EBV-mediated cancer |
|
|
most common brain malignancy
|
Mets
Lung > Breast > Skin (melanoma) > Kidney > GI Tract |
|
|
Charcot-Marie-Tooth disease
|
AD
peroneal nerve neuropathy leading to atrophy of lower legs legs have inverted bottle appearance |
|
|
pathogens associated with Guillan-Barre
|
campylobacter
M. pneumoniae |
|
|
acoustic neuroma
|
tinnitus and sensorineural hearing loss
|
