Ch. 1 Genetics Homework

Front 1

A biotechnology company, deCODE, is in the process of creating a database that contains

Back 1

health, genealogical, and genetic information of approximately 270,000 residents of Iceland.

Front 2

A biotechnology company, deCODE, is in the process of creating a database that contains

Back 2

health, genealogical, and genetic information of approximately 270,000 residents of Iceland.

Front 3

The genetic material DNA consists of basic units called

Back 3

nucleotides

Front 4

The genetic material DNA consists of basic units called

Back 4

nucleotides

Front 5

A biotechnology company, deCODE, is in the process of creating a database that contains

Back 5

health, genealogical, and genetic information of approximately 270,000 residents of Iceland.

Front 6

The immediate product of transcription is

Back 6

RNA

Front 7

The immediate product of transcription is

Back 7

RNA

Front 8

In many species, there are two representatives of each chromosome. In such species, the characteristic number of chromosomes is called......, which is symbolized as.......

Back 8

diploid, 2n

Front 9

In many species, there are two representatives of each chromosome. In such species, the characteristic number of chromosomes is called......, which is symbolized as.......

Back 9

diploid, 2n

Front 10

The genetic material DNA consists of basic units called

Back 10

nucleotides

Front 11

The immediate product of transcription is

Back 11

RNA

Front 12

A biotechnology company, deCODE, is in the process of creating a database that contains

Back 12

health, genealogical, and genetic information of approximately 270,000 residents of Iceland.

Front 13

The chromosomal theory of inhertiance says

Back 13

that genes of phenotypic traits are carried on chromosomes.

Front 14

The chromosomal theory of inhertiance says

Back 14

that genes of phenotypic traits are carried on chromosomes.

Front 15

The genetic material DNA consists of basic units called

Back 15

nucleotides

Front 16

In many species, there are two representatives of each chromosome. In such species, the characteristic number of chromosomes is called......, which is symbolized as.......

Back 16

diploid, 2n

Front 17

The immediate product of transcription is

Back 17

RNA

Front 18

The chromosomal theory of inhertiance says

Back 18

that genes of phenotypic traits are carried on chromosomes.

Front 19

In many species, there are two representatives of each chromosome. In such species, the characteristic number of chromosomes is called......, which is symbolized as.......

Back 19

diploid, 2n

Front 20

The chromosomal theory of inhertiance says

Back 20

that genes of phenotypic traits are carried on chromosomes.

Front 21

The largest category of proteins is

Back 21

enzymes

Front 22

Species characterizes as model organisms for a genetic study may have all but which of the following characteristics?
A. availability of a mutan strain
B. easy growth and maintenance
C. close evolutionary relationship to humans
D. Short Reproductive Cycle
E. Many Offspring Per Female

Back 22

C. Close evolutionary relationship to humans.

Front 23

A fundamental property of DNA's nitrogenous bases that is necessary for the double-stranded nature of its structure is

Back 23

Complementarity

Front 24

Recombinant DNA technology is dependent on a particular class of enzymes, known as....., that cut DNA at specific nucleotide sequences.

Back 24

restriction enzymes

Front 25

Alternative froms of genes are called

Back 25

alleles

Front 26

Organisms that are well understood from a scientific standpoint and are often used
in basic biological research are often called

Back 26

model organisms

Front 27

What are the features of DNA that suit it for its role as a hereditary molecule?

Back 27

- information storage
- replication
- relative stability while still retaining the ability to mutate or change**

Front 28

Name the nitrogenous bases in DNA and their pairing specificities.

Back 28

C-G, A-T
cytosine, guanine, adenosine, thymine

Front 29

What is meant by the term genetic code?

Back 29

The genetic code consists of a linear series of three adjacent nucleotides present in mRNA molecules. *

Front 30

What is meant by central dogma of genetics?

Back 30

The process of DNA trancribing into RNA translating into proteins.

Front 31

Compare and contrast non-enzymatic proteins and enzymatic proteins.

Back 31

Both: gene products and are composed of a string of amino acids.
Non: Structural(collagen), protective (immunoglobulin) and transport (hemoglobin).
Enzymatic: catalysts for most biochemical reactions. **

Front 32

If thymine makes up 15% of the bases in a certain DNA sample, what percentage of bases must be cytosine?

Back 32

35%

Front 33

A certain segment of DNA has the following nucleotide sequence in one strand:

ATTGGTGCATTACTTCAGGCTCTA

a) What must be the sequence in the other strand?
b) If the above strand is the template strand for a RNA molecule, what would be the sequence in the RNA transcript?

Back 33

a)TAACCACGTAATGAAGTCCGAGAT

b)UAACCAUAAUGAAGUCCGAGAU

Front 34

If a codon in mRNA is UUA, draw the tRNA anticodon that would bind to this codon.

Back 34

AAU

Front 35

Two mutations arise in separate cultures of a normally red fungus (which has only one set of chromosomes). The mutations are found to be in different genes. Mutation 1 gives an orange color and mutation 2 gives a yellow color. Biochemists working on the synthesis of the red pigment in this species have already described the following pathway:

Colorless precursor to yellow pigment by enzyme A
Yellow to orange pigment by enzyme B
Orange to red pigment by enzyme C

a) Which enzyme is defective in mutant 1?


b) Which enzyme is defective in mutant B?


c) What would be the color of a double mutant (1 and 2)?

Back 35

a) For the fungus to be orange, as in mutant 1, orange pigment would have to accumulate without changing to red. This would occur if Enzyme C was defective.
b) Enzyme B must be defective
c) Yellow due to lack of enzyme B **

Front 36

An albino mouse mutant is obtained whose pigment lacks melanin, normally made by enzyme T. The tissue of the mutant lacks all detectable activity for enzyme T. However, a western blot clearly shows that a protein with immunological properties identical with those of enzyme T is present in the cells of the mutant. How is this possible?

Back 36

Protein function can be destroyed by a mutation that causes the substitution of a single amino acid, even though the protein has the same immunological properties. A substitution of one of the key amino acids may make the enzyme totally non-functional, though there might be no effect on overall size and shape of the protein.