Use LEFT and RIGHT arrow keys to navigate between flashcards;
Use UP and DOWN arrow keys to flip the card;
H to show hint;
A reads text to speech;
122 Cards in this Set
- Front
- Back
|
How do hypotheses differ from theories?
|
Theories are more comprehensive than hypotheses.
|
|
|
You try to start your car, but it does not start. Which of these is a hypothesis?
|
My car's battery is dead.
|
|
|
Relative to prokaryotic cells, eukaryotic cells are usually ______.
|
larger and more complex
|
|
|
Which of these would Darwin not agree with: |
The idea that individuals striving to survive leads to better adapted species
|
|
|
What significant event occurred to Darwin while in Chile
|
An earthquake rose the shoreline 3 feet for hundreds of miles
|
|
|
While on the Beagle, Darwin was influenced by a book by Charles Lyell that suggested that Earth was ______ and sculpted by geologic processes that ______ today.
|
old . . . continue
|
|
|
Part of the first law of Lamark's theory was that a change in the environment led to a change in behavior, and that a change in behavior led to ___________________.
|
greater use or disuse of the structure
|
|
|
What accounts for the different breeds of domesticated dogs?
|
artificial selection
|
|
|
Dinosaurs (aside from the lineage that produced birds) were extinct by the end of the ______. |
Cretaceous
|
|
|
Evolutionary fitness is an often misunderstood concept. Which of the following imaginary individuals would have the greatest evolutionary fitness? |
Sparrow B
|
|
|
Which of the following is a characteristic of a non-trivial organization system?
|
You get more out of it than what you put in it.
|
|
|
The same evolutionary relationships are represented by the trees below. True or False.
|
False
|
|
|
Using the following evolutionary tree that depicts the relationships of Mayflies (yellow branches), Dragonfiles (Pink branches), and all other winged insects (light green branches). Which of the following is true: |
Mayflies and dragonflies share a recent common ancestor that had wings
|
|
|
Use the words falsifiable, repeatable, and testable, to describe the nature of science.
|
The nature of science basically states that people make hypothesis based on their observations that are testable. They then run repeatable experiments, (so that other scientists can run the same experiment and get the same results), to either falsify or legitimize their hypothesis. If the experiment proves the hypothesis it then becomes a theory, which is a fact that is falsifiable, meaning it can be disproven when new evidence is uncovered.
|
|
|
For the following questions, determine the ones that can be addressed by Science.
|
Can a human walk on water?
How old is the Earth? What morphological characteristics were likely present in the common ancestor of humans and chimps? How does coffee affect ulcers? Are humans most closely related to chimpanzees? |
|
|
What do scientists mean when they say that Evolution is a theory?
|
All theories are accepted ideas about something based on the evidence at hand. Scientists, do not think of them as fact however since they always leave them open to change and to be disproven by fact discovered at a later date. Thus all theories are believes that have not yet been proven inaccurate.
|
|
|
Darwin's Bulldog
|
Huxley |
|
|
Biblical literalist, ultimately killed himself |
Fitzroy |
|
|
Came up with the idea of natural selection independent of Darwin
|
Wallace |
|
|
Married Emma Wedgwood
|
Charles Darwin |
|
|
Captain of the Beagle
|
Fitzroy |
|
|
"The man who walked with Darwin"
|
Henslow |
|
|
Wrote "Principles of Geology"
|
Lyell |
|
|
Was born on the same day as Abraham Lincoln
|
Charles Darwin |
|
|
Medical Doctor, wrote how all organisms belong to one living filament
|
Erasmus Darwin |
|
|
I found this quote on a website: "There is no scientific proof that the earth is billions of years old. The average layman thinks there is, but he is mistaken." (www.christiancourier.com/articles/7-the-age-of-the-earth). Please demonstrate with at least two pieces of evidence why this statement is incorrect.
|
Radiometric dating, which is measuring the decay of certain elements in the rock layers, tells us how old the earth is. We can also see how old the earth is through something called molecular clocks by studying fossils. We can determine the amount of genetic changes in organisms and use that to estimate the time it took for that organisms to develop, thus giving us a general idea of the earth's age.
|
|
|
What events ultimately led Darwin to decide to publish Origin of Species?
|
A man named Wallace wrote to Darwin about a theory he came up with that was very similar to Darwin's own theory of Natural Selection. Wallace and Darwin published together their thesis. Then Darwin finished his book and had it published so as not to be trumped by other naturalists who where starting to discover what he had already learned.
|
|
|
Suppose you want to date the age of a trilobite fossil you found in the mountains of Dugway. You collect rocks that surround the fossil (from the same rock layer) and send them off to be radiometrically dated. If the half life of element X decaying into Y is 125 million years, and there is 1/16 of the original amount of X left in the rock you found. How old is the rock and therefore the fossil?
|
500 million years
|
|
|
Describe a situation in nature where genetic drift might be a more important influence on evolution than natural selection.
|
In a small isolated population genetic drift may have more to do with adaptation than natural selection because the randomness of genetic drift has the advantage with the small population.
|
|
|
Suppose a friend approaches you and says that Darwin was evil based on these points: (1) in the Origin of Species, Darwin teaches that humans evolved from apes, (2) that all religions teach that evolution cannot possibly be true, and (3) that there is no way that just random mechanisms could produce the diversity of life on the planet Correct your friend on these three points.
|
First off, Darwin actually did not mention human evolution at all in his book, the Origin of Species. Secondly, not all religion teaches that evolution is not true, and in fact many esteemed scientists also believe in God. Lastly, evolution is not random at all. Evolution is a process of slowly occur small changes within a species so that they are better able to live in their ever changing environments.
|
|
|
Briefly describe an example of how exaptation can cause “fast evolution”?
|
Birds evolved feathers to stay warm, but they also aided in flight. This caused the adaptation of flight to be "fast" because feathers already existed.
|
|
|
Identify each scenario as either a pre-zygotic or post-zygotic barrier to reproduction:
1 Populations never come into contact with each other 2 Offspring fail to reproduce 3 Male and female gametes fail to unite in fertilization. 4 Mating behaviors are not recognized by different organisms 5 Embryos are inviable and do not survive more than a few days 6 Genitalia structures are far too different to allow successful copulation |
1 pre 2 post 3 pre 4 pre 5 post 6 post |
|
|
Match the following species concept with one of its disadvantages.
1 Biological species concept 2 Phylogenetic species concept 3 Morphological species concept |
1 Applies only to sexual and contemporary populations. 2 Increased number of species 3 definitions are arbitrary and authoritative |
|
|
Which of the following are evidences that evolution has occurred (Mark all that apply): Choose at least one answer.
|
All of the different varieties of dogs that were artificially selected
Existence of vestigial organs All organisms share the same four DNA nucleotides (A T G C) The fossil record ? |
|
|
Why is a non-trivial or predictable classification system preferred in systematics?
|
So that you get more out of it than you put inDoes not get lost in experts debating where each species belongs
|
|
|
Mark all that apply: Which of the following is the equivalent to branching points on phylogenetic trees?
|
Nodes, Common ancestors, Speciation events
|
|
|
Use the following matrix, containing four taxa (A,B,C, and D) and five characters, to reconstruct the evolutionary tree. Choose the tree that best represents the evolutionary history. 0 = absent; 1 = present |
Tree 3
|
|
|
There are more species of ______ than of any other type of animal.
|
arthropods
|
|
|
______ have radial symmetry.
|
Cnidarians
|
|
|
Which of the following correctly illustrates the sequence of the origin of modern groups of plants? |
bryophytes, ferns, gymnosperms, angiosperms |
|
|
Humans are chordates. Which animal group is most closely related to chordates?
|
echinoderms
|
|
|
The feature present in reptiles and absent in amphibians that freed reptiles from dependence on water for reproduction is ______.
|
the amniotic egg
|
|
|
Which of these human characteristics evolved first?
loss of body hair development of culture upright posture enlarged brain language |
upright posture
|
|
|
Some of the oldest known fossils of Homo sapiens are at least ______ years old, although recently even older fossils have been found.
|
100,000
|
|
|
What behavior helps to define the genus Homo?
|
The use of tools
|
|
|
Sulfur has an atomic number of 16. How many covalent bonds can sulfur form?
|
2 |
|
|
In the equation 2 H2 + O2 → 2 H2O,
|
only H2O is a compound.
|
|
|
Water is a polar molecule because:
|
oxygen is more electronegative than hydrogen.
|
|
|
Unlike a rock, a reptile can sit in the hot sunshine without its body temperature soaring quickly. This is because the water in its body:
|
has a high specific heat
|
|
|
Water molecules are cohesive because they:
|
? |
|
|
High-fructose corn syrup is made from corn. The main carbohydrate in corn is a polysaccharide called
|
starch.
|
|
|
Large biological molecules are synthesized by removing:
|
water.
|
|
|
Which of the following is true with regard to a DNA molecule?
|
The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine.
|
|
|
Which of the following is the indigestible (at least for humans) glucose polysaccharide that is found in plants?
glycogen starch chitin cellulose |
cellulose
|
|
|
The results of dehydration synthesis can be reversed by
|
hydrolysis.
|
|
|
Information is transferred from the nucleus to ribosomes via ______.
|
mRNA |
|
|
Which of the following is a function of the Golgi apparatus?
|
protein modification
|
|
|
What structures move proteins from the ER to the Golgi apparatus?
|
transport vesicles
|
|
|
Many antibiotics work by blocking the function of ribosomes. Therefore, these antibiotics will:
|
block protein synthesis.
|
|
|
Which choice below correctly matches organelle with function?
|
smooth endoplasmic reticulum–lipid production
|
|
|
The sum total of all the chemical reactions that occur in organisms is called ______.
|
metabolism
|
|
|
Plant cells ______.
|
have chloroplasts and mitochondria
|
|
|
What compound directly provides energy for cellular work?
|
ATP |
|
|
Facilitated diffusion across a biological membrane requires ______ and moves a substance ______ its concentration gradient.
|
transport proteins . . . down
|
|
|
Which of the following best describes an enzyme?
|
They lower the energy of activation of a reaction by binding the substrate.
|
|
|
Which of the following statements regarding sexual and asexual reproduction is true?
Cell division only occurs after sexual reproduction. Sexual reproduction is more likely to increase genetic variation than is asexual reproduction. Sexual reproduction typically includes the development of unfertilized eggs. Only offspring from asexual reproduction inherit traits from two parents. |
Sexual reproduction is more likely to increase genetic variation than is asexual reproduction.
|
|
|
In meiosis, how does prophase I differ from prophase II?
|
During prophase I there is one diploid cell; during prophase II there are two haploid cells.
|
|
|
During telophase ______.
|
the events of prophase are reversed
|
|
|
How many autosomes do humans have?
|
44
|
|
|
The site on a chromosome where microtubules attach during cell division is the
|
centromere.
|
|
|
During metaphase I, ______.
|
homologous chromosomes line up in the middle of the cell
|
|
|
The cell cycle results in the production of ______.
|
two cells, each with the same amount of genetic material and the same genetic information
|
|
|
Which of the following statements regarding the cell-cycle control system is false?
The cell-cycle control system triggers and controls major events in the cell cycle. The cell-cycle control system includes three key checkpoints to complete a cell cycle. The cell-cycle control system receives messages from outside the cell that influence cell division. The cell-cycle control system operates independently of the growth factors. |
The cell-cycle control system operates independently of the growth factors.
|
|
|
Which of the following features likely accounts for the difference between plant and animal cell cytokinesis?
|
Plant cells have cell walls.
|
|
|
A karyotype is most like
|
photographs of every couple at a high school prom. |
|
|
According to the endosymbiotic theory and given the tree below, which was constructed from whole genome sequences or exemplar organisms from the three domains of life, where would be the most likely place for a branch containing the animal mitochondrial genome be connected? In other words, animal mitochondrial DNA is most closely related to the complete genome of which type of organism?
|
branch connected near A |
|
|
Why are you all Mommy's boys and girls?Explain why are you all more genetically like your mother than your father. Discuss endosymbiosis in eukaryotic evolution and the resulting outcomes.Hint: think to yourself: where did mitochondria and chloroplasts come from, and think about the size of X and Y chromosomes?
|
You could say that we are more like our mothers because we get all our mitochondria from our moms. Mitochondria have their own DNA and cannot be formed in cells that don't already have them. Instead they are absorbed into the cell and then they live in a kind of symbiotic relationship. Only the mother passes on these cells.
|
|
|
The origin of life (which is not the same as the theory of Evolution), is described as having a series steps (stages), leading to the formation of a pre-cell. Of the following list select those steps that are part of this "RNA world hypothesis".
|
Formation of simple monomers
Self replicating molecules (capable of passing on information) Monomers (simple molecules) to polymers Membrane (packaging molecules and separation from environment) |
|
|
Mark all of the following that ARE evolutionary adaptations leading to the modern human lineage. (You will need to mark all that apply)
|
less robust jaw
Less spacing between canines and adjacent teeth bipedalism A knee more centered along the midline of the body smaller cheek teeth |
|
|
Describe four scenarios where a proteins shape matters.
|
The shape of antibodies, which is kind of like a y, help them to bind to molecules that could be a threat.Transport proteins are smaller and rounder so that they can travel faster through the system. Enzymes have small holes in which molecules can go when undergoing chemical reactions.Other proteins are shaped to best carry nutrients across the cell membrane.
|
|
|
Imagine you are camping with some friends and as you throw a log on the fire you mention how heavy it is. You then (in a geeky biology voice) explain where the majority of the mass of the log came from to your friends. Please repeat your explanation below.
|
I tell them that the majority of the mass came from the air, because of the carbon that is striped from the carbon dioxide found in the air.
|
|
|
What are the three main products of cellular respiration?
|
Carbon dioxide ATP Water
|
|
|
What are the three main ingredients in photosynthesis?
|
Light Carbon dioxide Water |
|
|
Compare and contrast the advantages and disadvantages of Asexual and Sexual reproduction
|
In asexual reproduction you get an exact clone and are able to then pass on all your genes and you can reproduce quickly without the mess of courtship.With sexual reproduction the species can evolve faster due to the introduction of new genes, the rejection of less effective genes through rejection of courtship, and the many variations available as the offspring take on different traits from each parent.
|
|
|
In the film 'Why Sex?' a drought dried up pools with asexual and sexual reproducing minnows. Upon repopulating the upper pools, whatmechanism of evolution caused the sexually reproducing population to have very little genetic variation?
|
The population had very little genetic variation because the small number of fish began inbreeding so there was very little variation. This is an example of genetic drift |
|
|
The film 'Why Sex?' taught the evolutionary concept that organisms need to "run (evolve) just as fast as they can in order to stay right where they are." What was this idea called?
|
The Red Queen Theory
|
|
|
Assume that a mutation occurs in a human population that produces a horn (like a Unicorn) in the middle of the forehead. Further assume that the horn is inherited as a Y-linked trait in humans. A man with the horn has a daughter who has a son with a man who has lacks the horn. What is the probability that the horned man's grandson also has a horn?
|
0 |
|
|
Red-green color blindness is inherited as a sex-linked recessive trait. The gene is found on the X chromosome. How can a man with normal color vision father a daughter who is red-green color-blind?
|
He can't (unless there is a mutation).
|
|
|
An individual with (naturally) curly hair and an individual with (naturally) straight hair mate; all of their offspring have (naturally) wavy hair. What is the relationship between the alleles for hair texture?
|
incomplete dominance
|
|
|
To determine the phenotype of an individual who expresses a dominant trait, you would cross that individual with an individual who ______.
|
is homozygous recessive for that trait
|
|
|
What is a gene?
|
a unit of heredity
|
|
|
If one strand of a DNA double helix has the sequence GTCCAT, what is the sequence of the other strand?
|
CAGGTA
|
|
|
The correct sequence of events occurring during transcription is ______.
|
initiation, elongation, termination
|
|
|
If a strand of DNA has the sequence AAGCTC, transcription will result in a(n) ______.
|
single RNA strand with the sequence UUCGAG
|
|
|
The RNA that is translated into a polypeptide is ______ RNA.
|
messenger
|
|
|
The absence of a terminator in transcription will result in ______
|
the production of a longer RNA molecule
|
|
|
______ is(are) responsible for more cancers than any other carcinogen.
|
Tobacco
|
|
|
Inheritance of certain genes increases the risk of getting certain cancers; thus, it can be said that ______.
|
predisposition to these cancers is inherited
|
|
|
Which of these lifestyle choices will increase cancer risk?
|
a diet high in animal fat
|
|
|
Possible uses of reproductive cloning include ______.
|
the production of organs in pigs for transplant into humans
restocking populations of endangered animals the production of genetically identical animals for experimentation the production of potentially valuable drugs |
|
|
Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ______.
|
gel electrophoresis
|
|
|
You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to make the association?
|
you can use PCR to increase the amount of DNA available for restriction fragment analysis |
|
|
Gel electrophoresis separates DNA fragments on the basis of differences in their ______.
|
length
|
|
|
The small, circular loops of DNA in prokaryotic cells that are separate from the main chromosome and may harbor genes are called:
|
plasmids.
|
|
|
The human genome consists of about ______ chemical letters.
|
3 billion
|
|
|
Compare and contrast incomplete dominance and codominance. Use at least one example for each to illustrate your answer.
|
(Blending) Incomplete dominance is a phenotype of heterozygous individuals. An example would be hair color.(wavy hair when one parent has straight & the other curly) (See both traits) Codominance is both phenotypes of both homozygous to be produced in heterozygous individuals (palamino) |
|
|
How many characteristics of pea plants did Mendel choose to track through generations? What made these characteristics good choices to allow Mendel to deduce the fundamental principles of genetics?
|
Mendel studied 7 basic traits. He studied flower color, position, seed color, seed shape, pod shape, pod color, and stem length. |
|
|
Answer the next questions using the pedigree below. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing.
1. What would be the genotype of individual number 1? 2. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing. What would be the genotype of individual number 2? 3. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing. What would be the genotype of individual number 3? 4. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing. Given that individual #4 and an another individual with genotype Dd are married and want to have children. What is the probability that they have a deaf girl? |
1. D_
2. Dd 3. dd 4. ? |
|
|
My wife and I had three girls in a row, Amber, Melissa, and Camila and we recently had a little baby boy (so 3:1 ratio girls to boys). What is the chance that our next child (assume we have not determined the gender) will be male?
|
50% |
|
|
How many genes are in the human genome? How many protein products are produced? Please explain the process that can account for the disparity in these numbers.
|
There are about 40,000 genes in the human genome. There are 20,500 protein products produced. The disparity in between these two numbers happens because haploid genes get duplicated and it makes twice as much. |
|
|
There is "awesomeness" in the genetic code. Please list four observations I discussed in the "DNA Structure and Function 1" lecture" of the genetic code that could be part of its awesomeness.
|
1. There are 64 different bases 2. shows 20 amino acids that show patterns 3. There are patterns in all of them that will help determine what they are. Such as UUU being characterized as phenylalanine. 4. there is never a time where you can change the second position in a triplet and still have the same amino acid. |
|
|
While working with cultured mayfly cells, Dr. Ogden unknowingly treated the cells with a mutagen that although rare, causes deletion or insertion of individual bases in DNA. Subsequently, He isolated and cultured a single cell from this group and noticed that the progeny of this cell were not producing a certain protein and this was having an effect on their viability (even though mayflies are so cool). The mutation would be most harmful to the cells if it resulted in ______.
|
a single nucleotide insertion near the start of the coding sequence
|
|
|
Given the template DNA strand TACACCTCCCTACTACTCCCGGGATC, and that the string of bases CTACTACT represents an intron region.
1. What is the mRNA processed transcript? 2. How many codons are in this mRNA? 3. What is the fourth amino acid in the polypeptide chain? (Use the three letter symbol or the full name) |
1. AUGUGGAGGGGGCCCUA 2. 6 3. Glycine |
|
|
Based on the phylogenetic tree below, which of the following is most correct?
|
HIV evolved multiple times from SIV
|
|
|
Which of the following "bodily fluids" can be HIV infectious? (Assume the other substances contain no blood)
|
Breast milk Blood Vaginal secretions Semen |
|
|
How are missense and nonsense mutations the same and different?
|
? |
|
|
Explain three ways a proto-oncogene or tumor suppressor gene can lead to cancer.
|
? |
|
|
Assume that someone says to you that they cannot support any form of cloning because it is simply unnatural. Please debate this statement.
|
Cloning is sometimes seen as somewhat unethical, but its use has many scientific benefits. Cloning can bring a lot of good to the medical world. For example, cloning can help to make skin for burn victims, it can also be used to help make organs for the many thousands of people on the transplant waiting list. |
|
|
Semen from a rape victim (crime scene sample) was collected and analyzed. The image below shows evidence from a DNA Fingerprint analysis and includes samples from three suspects. Suspect #2 testifies that he is innocent and that he never even knew the girl. What can you conclude from the evidence:
|
The pattern clearly shows that the sample matches the crime scene sample.
|
|
|
Explain how the DNA fingerprint pattern is created and how this supports your response to the above question.
|
They put the genes into gel electrophorisis machine which gives sequences and the genes travel and some are slower and faster if they are the same then lines match |
|
|
Based on the two figures who is the father of the child and who was at the crime scene?
|
Male 1 and Suspect 1
|
|
|
What is the approximate probability of someone else having the same STR Profile as the one in this figure: Use the table below to calculate the probability.
Locus Allele FrequencyD3S1358120.015D3S1358130.015D3S1358140.1341D3S1358150.2896D3S1358160.2287D3S1358170.1616D3S1358180.1616D3S1358190.0152 VWA 120.015VWA140.1311VWA150.1189VWA160.186VWA170.2774VWA180.189VWA190.0884VWA200.015 FGA 180.015FGA190.061FGA200.125FGA210.1799FGA220.2287FGA230.1311FGA240.1463FGA250.0945FGA260.0183FGA270.015 |
39 out of 1,000,000 people
|
