Study your flashcards anywhere!

Download the official Cram app for free >

  • Shuffle
    Toggle On
    Toggle Off
  • Alphabetize
    Toggle On
    Toggle Off
  • Front First
    Toggle On
    Toggle Off
  • Both Sides
    Toggle On
    Toggle Off
  • Read
    Toggle On
    Toggle Off
Reading...
Front

How to study your flashcards.

Right/Left arrow keys: Navigate between flashcards.right arrow keyleft arrow key

Up/Down arrow keys: Flip the card between the front and back.down keyup key

H key: Show hint (3rd side).h key

A key: Read text to speech.a key

image

Play button

image

Play button

image

Progress

1/10

Click to flip

10 Cards in this Set

  • Front
  • Back
Most restriction sites are _______ base pairs long.
4 to 6
Which of the following enzymes would a bacterium most likely use to prevent its DNA from
being chopped up by its own restriction enzymes?
Methylase
Which of the following is a palindromic recognition sequence?

A) 5´. . . GTATAC . . . 3´
B) 5´. . . GTAATG . . . 3´
C) 5´. . . CATTAC . . . 3´
D) 5´. . . GATTAC . . . 3´
E) 5´. . . GTAGTA . . . 3´
*** A) 5´. . . GTATAC . . . 3´
DNA is _______ charged due to the presence of a _______ group.
negatively; phosphate
A RFLP
is a restriction fragment length polymorphism.

is inherited in a Mendelian fashion.

can be used as a genetic marker.

can be useful to help define a discrete allele of a gene.
In what way does a ddNTP differ from its dNTP counterparts?
The ddNTP is missing an —OH group.
In DNA sequencing, ddNTPs are added at much lower concentrations than are dNTPs. If
ddNTPs were added at higher concentrations, what would be the most likely result?
All of the reactions would terminate early and long strands would not be produced.
The fluorescent dye attached to ddNTPs in DNA sequencing
aids in visualization of the DNA strand when the ddNTP is incorporated.
The
following
DNA
molecules
form
a
double-­‐stranded
region.
5' ATATGGGCCATAGC 3'
3' GCGCTAGCCTACACTTCCTATACCCGGTATCGTCTTCTTTCCATTTGGGCTCTAACCA 5'
They
are
added
to
a
reaction
mixture
containing
DNA
polymerase
and
dGTP,
dCTP,
dATP
and
ddTTP.
What
is
the
expected
product
of
the
reaction?
5' ATATGGGCCATAGCAGAAGAAAGGT 3'
3' GCGCTAGCCTACACTTCCTATACCCGGTATCGTCTTCTTTCCATTTGGGCTCTAACCA 5'
In order to make a gene on a plasmid for expression of a human protein in bacteria, you have
to
insert a cDNA sequence into the plasmid so that the open reading frame is not disrupted by
introns

use a promoter in the plasmid that can be expressed in E. coli

make sure that the 5' UTR contains a Shine-Dalgarno sequence

make sure that the plasmid is ligated back into a circle before transformation