PCR Amplification Analysis

Improved Essays
PCR Amplification
Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5
…show more content…
After cooling to 60°C, 1X GelRed (Biotium) was added, and the solution was poured into a gel casting tray with a 15-lane comb. Once the gel had set, it was placed in the running apparatus (Bio-Rad) and submerged with 1X TAE buffer. DNA samples were prepared for loading by adding 1X DNA loading buffer (Fermentas, Life Technologies, 10mM Tris-HCl (pH7.6), 0.03% bromophenol blue, 0.03% xylene cyanol, 60% glycerol, 60mM EDTA). A 1kb ladder was loaded first followed by the DNA samples. The gel was operated at 100 volts for 30 minutes, and the results were visualized using a UV transilluminator (Kodak EDAS 290).
PCR Purification
This was done using the PureLink™ Quick Gel Extraction and PCR Purification Combo Kit (catalog #K220001) as described in manufactures protocol7. Nuclease free water was substituted for the elution buffer.
DNA

Related Documents

  • Decent Essays

    2.8 Gel Electrophoresis Gel Electrophoresis is a method used in the laboratory to separate compounds of DNA or RNA based on molecular size. The nucleic acid molecules are placed in a gel that contains small pores. With the negative charged nucleic acid, it travels towards the positive electrode. During the travel the molecules are separated whilst travelling through the small gel pores. The nucleic acid travels in the gel at the speed that is inversely related with its size.…

    • 100 Words
    • 1 Pages
    Decent Essays
  • Decent Essays

    2.1.3 Experiment tool kits Quantification PCR Power SYBR Green PCR Master Mix (Applied Biosystems #4368702) Real-time PCR TaqMan Reverse Transcription Kit (Applied Biosystems) DNA Extraction AxyPrep Midi and Maxi Plasmid Kits (Axygen #AP-MN-P50), Nucleobond Xtra midi (Nucleobond #E1910) Reporter Gene Assay Luciferase Assay Kit (Promega #1910)…

    • 46 Words
    • 1 Pages
    Decent Essays
  • Improved Essays

    Gram Staining Lab

    • 801 Words
    • 4 Pages

    Information about the Bacteria Pseudomonas aeruginosa During microbiology lab, an unknown bacteria culture in liquid broth was assigned to be identified by conducting a series of various tests. Nearly twenty different tests were conducted on the bacteria, but the most important of these was Gram staining test, gelatin stab test, and oxidase test. The results of these three tests allowed for the determination of the bacteria genus and species.…

    • 801 Words
    • 4 Pages
    Improved Essays
  • Improved Essays

    In this lab, many materials were used including, EcoRl restriction enzyme, DNA from the crime scene and subjects 1 through 5, centrifuge, water bath, DNA loading dye, Electrophoresis chamber, TAE buffer, and a fast blast stain. The EcoRl restriction enzyme is the enzyme that was used in order to cut the DNA at specific sites into many separate fragments. A centrifuge is a machine that uses a rotating container inside it in order to force all of the liquids to the bottom of the test tubes within the container. A water bath is a heated bath of water which is usually set at a specific temperature that is used to heat up substances. The DNA loading dye was used in order to visually see the DNA against the clear buffer solution and the clear agarose…

    • 695 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Pcr Investigation

    • 1016 Words
    • 5 Pages

    We went to the life centre to carry out PCR. We did this to investigate what our PTC genotype would be. To do this we had to carry out the following steps: DNA extraction, PCR and gel electrophoresis. I found that my genotype matched my phenotype, showing that I was a PTC taster and my genotype was hetero zygote taster. DNA extraction DNA is removed from human cells for a range of reasons.…

    • 1016 Words
    • 5 Pages
    Improved Essays
  • Improved Essays

    Thereafter, genomic DNA was obtained by the classical “phenol-chloroform” procedure for total DNA extraction. DNA was resuspended in 200 µL of buffer TE (10 mMTris-HCl; 1 mM EDTA; pH 8.0). The purity and yield of DNA extracted were evaluated by spectrophotometry at 260 and 280 nm (Epoch, Biotek Instruments, Winooski, USA). A260/A280 ratios in the range 1.8 – 2.0 were considered for long-term storage. DNA was diluted to a concentration of 10ng/mL before we genotyped the samples.…

    • 380 Words
    • 2 Pages
    Improved Essays
  • Improved Essays

    Ppar Rhy Lab Report

    • 585 Words
    • 3 Pages

    6. Quantitative determination of rat peroxisome proliferators activators γ (PPAR-γ): Rat PPAR-γ concentration was determined by ELISA; using a commercially available kit, MyBioSource, Inc., California, USA. The kit utilizing a monoclonal anti- PPAR-γ antibody and an PPAR-γ-HRP conjugate enzyme-linked immunosorbent process assay (ELISA) to determine the concentration of PPAR-γ in serum, plasma, urine, cell culture supernatant and tissue homogenates. Principle of the assay:…

    • 585 Words
    • 3 Pages
    Improved Essays
  • Superior Essays

    Aileen San BIO 210L – Section 4 A Prokaryotic System for Transformation, Expression, and Purification of Eukaryotic Proteins Introduction: The bacteria E.coli is found in many places such as in animal intestines and the environment. These bacteria have a simple structure and are quick to reproduce (Centers for Disease Control and Prevention, 2015). Because of this, scientists know a lot about E. coli. In this experiment, the E. coli will be exposed to a pGLO plasmid; each plasmid has an Ori, pBAD, araC, bla, and GFP.…

    • 1864 Words
    • 8 Pages
    Superior Essays
  • Decent Essays

    DNA Extinction Procedure

    • 278 Words
    • 2 Pages

    My hypothesis was correct, the ideal results reveal that suspect two was person who committed the crime. Sadly, the actual gel revealed very little and it was incredibly difficult to see and did not come out in the photo. The DNA I have obtained should be pure DNA, since it was filtered and separated from the rest of the solution there should be nothing else in it. In order to be certain of this an indicator could be used in order to test for other substances.…

    • 278 Words
    • 2 Pages
    Decent Essays
  • Improved Essays

    The agarose gel is poured onto a plastic plat forming wells, and then DNA samples are placed in small wells. When samples are added to their relative wells, gel and plastic plate are…

    • 1612 Words
    • 7 Pages
    Improved Essays
  • Great Essays

    Phylogenic Analysis

    • 1168 Words
    • 5 Pages

    Electrophoresis Electrophoresis of DNA run in 2% agarose gel showed successful extraction of DNA in samples 1-8, 12 and 14-16. Samples were of good quality with high molecular weights (Figure 2). Samples 11 and 13 in Row 1 of gel 2 were not easily visible and thus the molecular weight was difficult to…

    • 1168 Words
    • 5 Pages
    Great Essays
  • Great Essays

    First, students swabbed the inside of their cheek for at least 30 seconds with a cotton swab to obtain their sample for DNA extraction. 180 µl of Buffer ATL and 20 µl of proteinase K were added to the swabbed sample using sterile micropipetting techniques. The swabbed samples were incubated at 56 ⁰C in a hot block. Next, students isolated their HV1 control region DNA through a series of washes which contained 200µl of Buffer ATL, 200µl of ethanol, 500 µl of Buffer AW1 and AW2, and 50 µl of Buffer AE (Penn State Biology 220W Lab Manual, pgs. 48-49)…

    • 1855 Words
    • 8 Pages
    Great Essays
  • Superior Essays

    By Chelex based DNA isolation, DNA was isolated from buccal cells to study the genes TAS2R38, CDK3, ADH/ALDH, and D1S80. It was hypothesized that after gel electrophoresis, the TAS2R38 DNA sample will be cleaved at two places, since by the taste test was positive for PAV. The CDK3 gene will display one or two bands and the ADH/ALDH was expected to form one or three bands based on homozygosity or heterozygosity for the gene. D1S80 will have repeated sequences from 14 to 72 repeats. After examining the DNA ladder in figure one, the CDK3 gene had three bands from 100, 250, and 300 base pairs.…

    • 819 Words
    • 4 Pages
    Superior Essays
  • Great Essays

    There is two specific PCR primer were designed to amplify gene in expected size of 1500bp of a consensus 16S rRNA: forward primer, 8f and reverse primer, U1492R. The process of PCR is done by the program of thermal cycle and repeat. Each DNA used in PCR is serve as a template. The PCR product then is analyzed by agarose gel electrophoresis. Agarose gel electrophoresis is the common and easy way to analyze DNA where that DNA is visualized in the gel.…

    • 1716 Words
    • 7 Pages
    Great Essays
  • Great Essays

    when we extracted DNA, we used Proteinase K (Pro K) digests to mix it with it and touch spinning it to extract all genomic DNA. We added to it Lysis before just to make sure there is no damage to the DNA membrane. We amplified DNA sequences of our cheek cells using polymerase chain reaction technique. We placed our DNA that contains master mix on the ice container so it does not get denatured while setting up out the PCR mixture. As a group, we set up our master mix and all all the mixtures we need in it to decrease the percentage of errors which could be done.…

    • 1870 Words
    • 8 Pages
    Great Essays

Related Topics