Nicotne Analysis

Superior Essays
Introduction
Tobacco use is one of the major threats to human health which kills nearly 6 million people each year with an estimated 8 million deaths in the year 2030. More than 2,500 chemicals are found in tobacco and its smoke, among which terpenoids and alkaloids are the major groups [1]. Though there is clinical uncertainty about the carcinogenic property of nicotine, evidences have proved nicotine as the main psychoactive agent responsible for the development of tobacco dependence [2, 3]. Nicotine diffuses readily into brain tissue where it binds to nicotinic acetylcholine receptors reinforcing addiction. It is estimated that 3-5 mg/day is the threshold level that readily establishes and sustains addiction among smokers [4]. The LD50 of
…show more content…
First strand cDNA was synthesized with DNase I treated RNA and antisense primers for the reference gene (β-ATPase), target genes (PMT1/5, PMT2/4, PMT3 and HCT) (supplementary table 1). In a total reaction volume of 30µl, RNA (3µg) dNTP’s (10mM) antisense primers (5picomoles) and DTT (5mM) were added and denatured at 65oC for 5minutes. Then, the samples were plunged into ice. To this reaction mix, 50 Units of reverse transcriptase (MuMLV) and reverse transcription assay buffer (5X) was added and incubated at 30ºC for 5 minutes. First strand cDNA was synthesized at 42ºC for 60minutes. Thereafter, the abundance of the PMT members and HCT was studied using gene specific sense primers by qPCR (Light Cycler LC480, Roche Diagnostics). Sense and antisense primers were designed using IDT. Sense primers specific for genes and antisense primers for a conserved region of the PMT genes. Quantitative PCR was performed in a 20µl reaction using Light Cycler 480 SYBR Green I master mix as per the manufacturer’s protocol. Previously, individual primer pairs were validated for PCR efficiency using the slope obtained in qPCR. All experiments were carried out in

Related Documents

  • Improved Essays

    Reverse Transcriptase Master Mix was then used for the reverse transcription reactions by putting the miRNAs in a thermocycler to convert them into single stranded DNA. Finally, qt-PCR was used to analyze the levels of…

    • 882 Words
    • 4 Pages
    Improved Essays
  • Decent Essays

    2.1.3 Experiment tool kits Quantification PCR Power SYBR Green PCR Master Mix (Applied Biosystems #4368702) Real-time PCR TaqMan Reverse Transcription Kit (Applied Biosystems) DNA Extraction AxyPrep Midi and Maxi Plasmid Kits (Axygen #AP-MN-P50), Nucleobond Xtra midi (Nucleobond #E1910) Reporter Gene Assay Luciferase Assay Kit (Promega #1910)…

    • 46 Words
    • 1 Pages
    Decent Essays
  • Improved Essays

    PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5…

    • 742 Words
    • 3 Pages
    Improved Essays
  • Brilliant Essays

    Rasmussen R. (2001) In: Rapid Cycle Real-time PCR, Methods and Applications (S. Meuer, C. Wittwer, K. Nakagawara, Eds.), Springer Press, Heidelberg, 21-34. 38. Ratcliff F., Harrison B.D., Baulcombe D.C. (1997) Science, 276, 1558-1560.…

    • 490 Words
    • 2 Pages
    Brilliant Essays
  • Superior Essays

    Many smokers struggle to quit smoking each year; unfortunately, the majority of them are unsuccessful. However, a present trend that has hit the market for about a decade or so is known as electrical cigarettes or vaping. This new development is assumed to help fight the craving and smoking cessation. It is growing in popularity across the United States and in England, with its advertised benefits of a safer approach to consuming nicotine. These electrical cigarettes are promoted to help prospective quitters a healthier tobacco-free life.…

    • 1453 Words
    • 6 Pages
    Superior Essays
  • Decent Essays

    Nicotine also attaches itself to the receptors of acetylcholine. References:…

    • 108 Words
    • 1 Pages
    Decent Essays
  • Improved Essays

    Evaluating Substance Abuse Client Cases Synopsis of case Angela is 41 years old African American woman from North Carolina (NC). She has been smoking for a number of years. Angela does not consider herself to be an addict because she does not used other drugs. She tries quitting using a nicotine patch which did not help.…

    • 782 Words
    • 4 Pages
    Improved Essays
  • Improved Essays

    Therefore, there will be a difference in target nucleic acid presence and the CT value. The CT (threshold cycle) obtained from real-time PCR for both known and unknown (#4) were Known- 31.37 Unknown -35.3 The higher CT value (over 29) indicated lower amount of target nucleic acid which correlated with less number amplification in qPCR.…

    • 734 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Beliefs and Perspectives about Addiction This information has allowed me to look at the effects of alcohol and drugs from a different point of view. These desires and cravings affect the brain. Van Wormer and Davis (2013) claim that nicotine is the highly addicted.…

    • 379 Words
    • 2 Pages
    Improved Essays
  • Great Essays

    After completing a series of washes, students quantified the amount of DNA in their sample using the NanoVue Spectrophotometer. Using their results from the NanoVue, students were able to determine the amount of their sample DNA and PCR master mix they needed to add to PCR tubes. Then, the samples were loaded into the PCR machine to amplify DNA samples. Once the PCR cycle was complete, samples were stored in a freezer at -20⁰C. With the products from PCR, students used Gel Electrophoresis to separate electrically charged molecules. Gel Electrophoresis requires 3 steps; preparing a gel solution, gel electrophoresis, and photographing the gel.…

    • 1855 Words
    • 8 Pages
    Great Essays
  • Improved Essays

    Dementia Substance Abuse

    • 806 Words
    • 4 Pages

    Tobacco also affects the brain in underlying ways. Tobacco contains a very powerful drug, Nicotine, that makes tobacco become addictive. This addictive drug causes changes to the brain that make one anxious, moody, nervous, and even depressed after smoking. Eliminating this drug from one’s system can create a healthier lifestyle, non dependent on nicotine. Therefore, reducing the risk of brain degenerative diseases such as Alzheimer’s.…

    • 806 Words
    • 4 Pages
    Improved Essays
  • Improved Essays

    The primer sequences were as follows: p53: 50-ATGTGGTGCCTGCCTCAGA-30 (sense) 50-CTTCGTCCTTCACCATCAGCTT-30 (antisense) β -actin: 50-TGACAACGGCTCCGGTATG-30 (sense) 50-TTCTGTCCCATGCCAACCAT-30 (antisense)…

    • 1328 Words
    • 5 Pages
    Improved Essays
  • Improved Essays

    Adolescents often use smoking as a form of dealing with stress, anger, or generally boosting their moods (Curry, S.J., Mermelstein, R.J., & Sporer, A. K., 2009). While NRT and other medications have shown to be helpful in treating the nicotine addiction, this comes secondary to the original problem at hand: mood control. One idea is instead of dealing with the symptoms as they come up - i.e. self-medication through the use of nicotine - perhaps in some cases it would behoove the youth to use pharmaceutical therapy in the treatment of the underlying condition or stressor. Whereas part of the reason why this occurs in the first place will be addressed momentarily, it still needs to be treated.…

    • 440 Words
    • 2 Pages
    Improved Essays
  • Improved Essays

    Smoking Persuasive Speech

    • 744 Words
    • 3 Pages

    Stop Smoking Does anyone in your family or even one of your friends smoke? Well, if they do, they could be in a lot of danger. Many people are at risk when they smoke cigarettes. There in danger because many people die from cancer each year, which is caused by smoking. Smoking is bad and trying to stop is the best way to live life longer and healthier.…

    • 744 Words
    • 3 Pages
    Improved Essays
  • Superior Essays

    Many people smoke a couple of cigarettes and before they know it they’re hooked and can’t shake the bad habit of smoking cigarettes. The product in cigarettes that get people addicted is nicotine. Nicotine is not one of the cancerous products in cigarettes, nicotine is what makes smokers addicted (Is Smoking Really Addictive?). There is a huge psychological connection between the mind and nicotine, this is what often causes relapses after one does quit smoking (Is Smoking Really Addictive?). Nicotine is a poison, in small doses nicotine is extremely hard to shake.…

    • 1675 Words
    • 7 Pages
    Superior Essays

Related Topics