Pcr Lab Report

Superior Essays
Purifying DNA to Estimate its Purity using PCR Amplification of VNTR to Load and Run Agarose Gel

Introduction

The study of this experiment was the Dopamine transporter gene. This gene is associated with different brain disorders like bipolar, as well as certain behavioural traits such as ADHD.[1] Dopamine transporter gene is a presynaptic plasma protein containing different VNTRs in it’s UTR and plays an important role in restricting the activity of dopamine by rapid reuptake into the presynaptic neuron. DAT is part of Na+ and Cl- dependent family with the addition of other neurotransmitter transporters such as, GABA, serotonin, glycine, and norepinephrine transporters. The 3' UTR of this gene contains a 40 bp tandem repeat.[4] Dopamine
…show more content…
As well as DNA, RNA molecules are also able to absorb UV light at 260nm as they contain amino acids, therefore, they both contributed to the total result.

Agarose Gel Electrophoresis of DAT VNTR PCR Products

DNA denatures causing a smear as when the gene is stuck to an enzyme, the DNA fragments can be seen in a smear on an agarose gel after performing electrophoresis.[5] For this test, a small sample of DNA that had been isolated was loaded into a well in the agarose gel which was then exposed to an electric field. DNA is negatively charged so moved towards the anode. Due to small fragments of DNA moving faster, the DNA was separated in size. This can be seen in figure 1.

IMG_0698.JPG

Figure 1

Image of agarose gel taken by a UV transilluminator.

A few PCR bands can be seen in figure 1.
…show more content…
However, some affecting factors were unavoidable and can be classed as human error. In future, these small mistakes can be avoided by just simply working at a steady pace and ensuring all equipment is working correctly such as the timer on the powerpack. Furthermore, practice should be done for pipetting samples into the agarose gel so that there is no hesitation, overfilling or underfilling during the procedure. If these slight errors were not to contribute to the experiment next time, I am certain the results will portray clear PCR bands for a more detailed

Related Documents

  • Superior Essays

    Unknown Plasmid Lab Report

    • 1066 Words
    • 5 Pages

    Identifying an Unknown Plasmid Through the Process of Gel Electrophoresis Introduction: Biotechnology requires certain techniques and methods that help identify plasmids, which can be used for forensics, DNA fingerprinting, etc. In this class, each lab focused on teaching the process of using the correct techniques used to identify a plasmid. Plasmids are pieces of DNA that are circular and relatively smaller than chromosomes. They aren’t important in the sense that they don’t carry out critical functions required for growth and life. Also, they are located in the cytoplasm, outside of the chromosome and nucleus of a cell.…

    • 1066 Words
    • 5 Pages
    Superior Essays
  • Great Essays

    Oral Microbiome Essay

    • 2001 Words
    • 9 Pages

    To start these procedures a person will do a test using Colony PCR. This will be done by touching a toothpick to a selected colony and swirling with the matching 25 uL of PCR. Lastly, a person will visualize their DNA using gel electrophoresis. First, add 1.0 uL of 10X loading dye and 10uL PCR product and mix. Then Use a micropipette to load 10 uL of sample in the next open well, this will be adjacent to the preloaded DNA ladder done by the teaching assistant.…

    • 2001 Words
    • 9 Pages
    Great Essays
  • Superior Essays

    Unknown Lab Report

    • 1472 Words
    • 6 Pages

    This determination lead to the test of gelatin hydrolysis test, followed by a urease test, and lastly a lactose fermentation test. To narrow down our possible potential organisms that match our unknown, that would lead to accurately identifying our…

    • 1472 Words
    • 6 Pages
    Superior Essays
  • Improved Essays

    When the drug was first introduced it was sold as a racemic mixture of the isomers, but today the drug is also sold as with only d-threo-methylphenidate. Studies have shown there were few differences in binding affinities between the isomers (Markowitz). However, studies using Positron Emission Tomography in the human brain with radioactively-labeled methylphenidate have shown that therapeutic doses block more than 50% of the dopamine transporters, and significantly enhance extracellular dopamine (DA) in the basal ganglia. Recent in-vitro studies have shown d-methylphenidate exhibits significant affinity with the norepinephrine transporter as well as the dopamine transporter when compared to l-methylphenidate (Hannestad). These studies have shown methylphenidate to be potent inhibitor of both the dopamine transporter and norepinephrine transporter with experimentally determined KIs of = 0.06 μM and 0.10 μM respectively.…

    • 1154 Words
    • 5 Pages
    Improved Essays
  • Superior Essays

    Alibrio Ficheri Lab Report

    • 1332 Words
    • 6 Pages

    A. fischeriThe overall purpose of this study was to create a genomic library of Aliivibrio fischeri (A. fischeri) thus aiding in creating a restriction map of the lux operon. It also employs typical molecular techniques important for biologists to understand. In this portion of the lab, the chromosomal DNA (chDNA) will be isolated. Its purity will be measured using spectrophotometric analysis. Lastly, the DNA will be digested and verified via gel electrophoresis.…

    • 1332 Words
    • 6 Pages
    Superior Essays
  • Great Essays

    Matt Ridley

    • 1042 Words
    • 5 Pages

    It discusses how dopamine is in chromosome 11, and it activates the person’s mind and gets it going. It then discusses D4DR, a gene on the chromosome that is process in making dopamine (Ridley). The more of D4DR then a lesser degree of dopamine, and the less of it then a greater degree of dopamine. Ridley then brings up serotonin as well, and he discusses that it is related to dopamine. The less serotonin in a person means that he or she will act on impulse as opposed to the genes with a greater serotonin level.…

    • 1042 Words
    • 5 Pages
    Great Essays
  • Superior Essays

    Unknown Lab Report

    • 1513 Words
    • 7 Pages

    From that, different tests were performed to be able to find the specific identity of bacteria further tests will be explained in each specific method…

    • 1513 Words
    • 7 Pages
    Superior Essays
  • Improved Essays

    Substantia Nigra

    • 1753 Words
    • 8 Pages

    Another factor that contributes to dopamine accumulation is an enzyme called MB-COMT, Membrane-bound Catechol-O-methyltransferase.…

    • 1753 Words
    • 8 Pages
    Improved Essays
  • Improved Essays

    The Enzyme Electrophoretic Separation of Proteins lab experiment will take place on March 7th, 2017, from 2:00pm to 5:00pm. It is important for students to follow lab safety guidelines in order to prevent any complications that may be a risk to one's health. For this experiment, students must wear their lab coat, goggles, and gloves at all times. All materials in this experiment should be handled with caution to avoid any damages. Students must keep hands away from face, eyes, and mouth, when being in contact with chemicals.…

    • 509 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Neurons do not readily react to the same amount of dopamine after repeated over-stimulation of neurotransmitter (Cho and Melega, 2001). It also undergoes adaptive change as neurons weakly response to dopamine. Repeated methamphetamine use also causes reduction in dopamine transporter availability. According to the study conducted Volkow et al. (2007), it is found that dopamine transporter availability is significantly lower in methamphetamine abuser.…

    • 904 Words
    • 4 Pages
    Improved Essays
  • Decent Essays

    First lane is the protein ladder which is used as a reference and to estimate the size of different proteins. Lane 1 in the green box contains cow serum which shows high mobility since it dyes all the way to the bottom with different bands through the gel. Lane 2 contained one dark band at the bottom of the gel. Lane 3 shows o dark band with low mobility through the gel. Lane 4 shows one band stained with medium mobility through the gel.…

    • 358 Words
    • 2 Pages
    Decent Essays
  • Improved Essays

    Results Primer design and LAMP reaction Among 40 different primers (OPA 1-20 & OPB 1-20 series) screened by RAPD PCR for differentiating the Mycosphaerella eumusae from other leaf spot causing fungal pathogens in banana, only the primer OPB 10 has generated a unique amplicon specific to M. eumusae at 1300 bp size. A total of nine different sets of LAMP primers were designed based on this specific SCAR derived RAPD marker sequence of M. eumusae and screened for the production of LAMP products (Fig. 1). Out of nine sets of primer screened, only one set of forward and backward inner primers viz. , FIP1L-GTCTGGAAGCACGCCAATCTGT-TACTTGAAGGCATGCACCAC and BIP1L- TTCGCAACCTCATCGACGTTGT-TCCAGTACTCATTGGCCTCC along with outer primers F3- GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color.…

    • 1752 Words
    • 8 Pages
    Improved Essays
  • Great Essays

    Neutral Community Theory

    • 1574 Words
    • 7 Pages

    Neutral community theory, also known as the unified neutral theory of biodiversity and biogeography was set-forth in literature in 2001 by Stephen Hubbell however it draws largely upon pre-established, and widely accepted, ecological theories of island biogeography (MacArthur and Wilson, 1967). The original model proposed by MacArthur and Wilson was constructed to account for variation in the composition of birds found in different sized areas as well as their relative abundance and compositional changes over temporal and spatial locations. The basic frame-work of the neutral model was that the number of species (species, used here in the ecological concept wherein a species is a set of organisms adapted to a particular set of resources and…

    • 1574 Words
    • 7 Pages
    Great Essays
  • Superior Essays

    Observation of plant and animal cells through a light microscope. A cell is the most basic structure of any living organism and is capable of independently reproducing. Cells can be grouped into two categories, prokaryotic and eukaryotic. In a eukaryotic cell there are small organelles that carry out specific functions which can be compared to the organs in the human body.…

    • 1589 Words
    • 7 Pages
    Superior Essays
  • Improved Essays

    Starch Lab Report

    • 1016 Words
    • 5 Pages

    In experiment 2.1, absorbance readings for both heated and unheated corn and tapioca starch were taken. For both starch’s the heated results came to be much higher then the un-heated as seen in Table 2.1. Iodine reacts with the amylose compound in starch where it gets trapped in the amylose coils and blue-ish colour is formed after the addition of Lugols reagent (Fennema and others 2008). The absorbance readings came out higher for heated corn starch because iodine had more amylose to react with. As corn-starch is heated gelatinization occurs where amylose is released since the starch granule is disrupted.…

    • 1016 Words
    • 5 Pages
    Improved Essays