PMT Genes

Great Essays
Results
Design of the RNAi vector
The PMT gene family is well conserved among the Solanales. There are five genes in the PMT gene family (PMT1 to PMT5) which differ in the exon 1 sequence due to the insertion of a variable number of 33 nucleotide repeats. This makes the first exon as an ideal region for the design of gene specific RNAi trigger sequence (Fig 1A). Full-length sequences are available for four PMT genes (PMT1 to PMT4) whereas only the sequence of exon1 is known for PMT5 which shares 95% identity with PMT1. The PMT4 contains 6 insertions of 33 nucleotide repeats (198 bases) in exon 1. The exon 1 sequences of the five PMT genes were analyzed to design a trigger sequence that is specific to the major PMT gene, PMT2. A 162bp sequence
…show more content…
The sequence characteristics of the RNAi trigger sequence used for silencing plays major role in both. The 162bp RNAi trigger sequence used in the present study was derived from the PMT2 gene, which is the major gene (highly expressed) in the 5-member PMT gene family. The trigger sequence was derived from the first exon, which showed the maximum divergence primarily due to the insertions of a variable number of 33 nucleotide repeats (Fig 1). It was designed to target the major PMT2 gene, but cross silencing of the minor PMT4 genes was also expected. PMT1, PMT3 and PMT5 genes may also be cross silenced to some extent due to the sharing of 22 nucleotide perfect match sequences with the RNAi trigger. The 162bp RNAi trigger sequence contained guide siRNA sequences with preferred thermodynamic properties for efficient silencing. The spacer sequence used to generate hairpin dsRNA of the trigger sequence also play a crucial role in the silencing of the target genes [24, 25]. RNAi trigger with intronic spacers provides a dsRNA template for efficient Dicer processing, and thereby, increases the efficiency of the RNAi vectors [25, 26]. We have used the native intron including the conserved 5’ and 3’ splice sites as a self-cleaving spacer. This may be one of the reasons that we have observed the highest level of silencing as evident from the low nicotine content found …show more content…
In the present study, constitutive silencing of PMT genes was targeted to block or reduce the expression of putrescine methyl transferase that catalyzes the conversion of putrescine to methyl putrescine. As a consequence, accumulation of putrescine and nicotinic acid derivatives was expected. It was reported that silencing of PMT genes resulted in an increased level of putrescine and spermidine in Nicotiana sylvestris [14] and anatabine in Nicotiana tabacum [15]. Silencing of ADC, which converts arginine to putrescine and ODC which converts ornithine to putrescine also produced low nicotine plants with increased levels of anatabine in Nicotiana tabacum [16, 17]. Anatabine is a toxic alkaloid derived from nicotinic acid and is a cholinergic agonist. MS, ESI spectra of the low nicotine RNAi plants in positive and negative mode did not show accumulation of anatabine. Instead, we report for the first time that reduction of nicotine content results in a concomitant increase in the content of chlorogenic acid. Chlorogenic acid is an ester formed between caffeic acid and quinic acid with proven antioxidant properties [14, 33]. Silencing PMT genes accumulate putrescine that can combine with hydroxycinnamates to produce hydroxy cinnamate-putrescine conjugates such as caffeoyl putrescine,

Related Documents

  • Improved Essays

    Oseltamivir: A Case Study

    • 632 Words
    • 3 Pages

    Oseltamivir is an antiviral drug used in the treatment and prophylaxis of both influenza virus A and influenza virus B. It was approved for seasonal influenza by US Food and Drug Administration in 1999, and approval from Japanese agencies and European Medicines Agency (EMA) followed soon afterwards. A pharmaceutical company Roche launched oseltamivir in the global market with Tamiflu as its brand name. In 2007 alone this pharmaceutical company was producing 400 million doses of the drug with a market value of 2.2 billion US dollars, and benefitted by more than 18 billion US dollars since the launch of the drug.…

    • 632 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Molecular, Cellular, Developmental Biology (MCDB). " MCDB 1AL". Lab handbook. University of California, Santa Barbara.…

    • 1849 Words
    • 8 Pages
    Improved Essays
  • Great Essays

    Fruit Fly Lab Report

    • 1571 Words
    • 7 Pages

    The studies of this gene and where it can be found across different taxa is not the only thing that can make a remarkable change in science. It…

    • 1571 Words
    • 7 Pages
    Great Essays
  • Decent Essays

    2.1.3 Experiment tool kits Quantification PCR Power SYBR Green PCR Master Mix (Applied Biosystems #4368702) Real-time PCR TaqMan Reverse Transcription Kit (Applied Biosystems) DNA Extraction AxyPrep Midi and Maxi Plasmid Kits (Axygen #AP-MN-P50), Nucleobond Xtra midi (Nucleobond #E1910) Reporter Gene Assay Luciferase Assay Kit (Promega #1910)…

    • 46 Words
    • 1 Pages
    Decent Essays
  • Improved Essays

    PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5…

    • 742 Words
    • 3 Pages
    Improved Essays
  • Decent Essays

    Trimidox Research Paper

    • 174 Words
    • 1 Pages

    Trimidox (hydrochloride) is a specific ribonucleotide reductase inhibitor [1][2][3]. Ribonucleotide reductase is the rate-limiting enzyme for de novo DNA synthesis. This enzyme is linked with proliferation and malignant transformation, and is a common target for cancer chemotherapy [1][2]. Trimidox (hydrochloride) is a specific ribonucleotide reductase inhibitor. Trimidox inhibited the activity of ribonucleotide reductase in extracts of L1210 cells with IC50 value of 5 μM. Trimidox was cytotoxic to L1210 cells with IC50 value of 7.5 μM [3].…

    • 174 Words
    • 1 Pages
    Decent Essays
  • Decent Essays

    Summary: ״The CRISPR Conundrum״ “The CRISPR Conundrum” (2016) by Mary Bates, describes “CRISPR”- clustered regularly interspaced short palindromic repeats, which is a new revolutionary technology in genetic engineering. It is a kind of molecular scissors that can be programmed to snip specific bits of DNA. The article talks about the advantages of CRISPR, yet it describes CRISPR’s disadvantages as well. On the one hand, CRISPR is a cheap and precise technique to edit the DNA of animals, plants and even humans.…

    • 271 Words
    • 2 Pages
    Decent Essays
  • Decent Essays

    Alignment was performed with tophat v2.0.6 (http://tophat.cbcb.umd.edu). Alignments were processed using SAMtools v0.1.2, which generates site-specific allele frequencies using overlapping reads (read pileup). Allele specific expression was quantified by determining whether or not each overlapping read at mutant site matched the reference or the alternative allele. These summed counts represented our measures of relative allelic abundance at that site. Any deviation from equal allelic abundance was reflected allelic imbalance.…

    • 69 Words
    • 1 Pages
    Decent Essays
  • Improved Essays

    The nicotine found in the neonicotinoid have these negative effects. The nicotine effects the function of the brain and nervous system in humans like it does with the bees and aquatic invertebrates (Kuroda,…

    • 1338 Words
    • 6 Pages
    Improved Essays
  • Improved Essays

    CRISPR, a revolutionary idea, a project that can help humanity or damage it. The DNA that is known as CRISPR-cas9 has been said to do incredible things, but also horrible things. Another problem is that in this world today who owns the patent, who can truly say that this was their discovery, and what does CRISPR really do? Clustered regularly interspaced short palindromic repeats, CRISPR for short, are segments of DNA that contain short, repeating sequences.…

    • 450 Words
    • 2 Pages
    Improved Essays
  • Improved Essays

    Nicotine Research Paper

    • 928 Words
    • 4 Pages

    SCIENCE DRUG REPORT – NICOTINE – Lily Gherbaz Nicotine is the chemical in tobacco, which makes tobacco smoking addictive. The chemical formula is C10H14N2 (shown in the diagram below). When nicotine is delivered into the lungs by inhaling smoke, mood and behaviour are regulated from the increase in the release of brain chemicals called neurotransmitters. (Chemical Properties, n.d.)…

    • 928 Words
    • 4 Pages
    Improved Essays
  • Improved Essays

    There are four stages that take place during transcription which are: binding, initiation, elongation, and termination. The first stage of transcription is binding. The binding stage starts with RNA polymerase attaching to a DNA promoter site. The enzyme then is guided by a sigma subunit which separates a portion of the DNA strand where the replication process will begin and this called the start point. The TATAAT sequence is another important portion of the DNA strand, which is located “10 bases upstream from the start point” (pg. 657) This is important because it is a promoter and guides RNA polymerase.…

    • 514 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    There will be three assays will be made and tested with both known and unknown plasmid. The first assay contains both PGEX-F1 primer and PGEX-R primer. Both primers enable to do replication with PCR in both Watson(top) strand and Crick(bottom). The presence of Saw1 insertion gene will not matter in this assay.…

    • 734 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    The gel was excised after the electrophoresis, and later subjected to gel purification to recollect the RNAIFAD2.1 and RNAIFAD2.2 DNA using the standard protocol provided with the GeneJet Gel Extraction Kit. The DNA after transcribed in the cells of the pennycress will adopt a miRNA shape due to its complementary sequence flanked by inverted repeats favoring a hairpin formation. The purified gel extracted RNAIFAD2.1 and RNAIFAD2.2 were then subjected to a restricted digest using BAMH1 and XHO1 restricted enzymes along with our donor vector pENTR 2B. The reaction was incubated for 1 hour in 37° water bath.…

    • 912 Words
    • 4 Pages
    Improved Essays
  • Improved Essays

    Benzocaine was synthesized from p-toluidine in a four step synthesis. Each intermediate product, including N-acetyl-p-toluidine, p-acetamidobenzoic acid, and p-aminobenzoic acid, was checked for yield, presence, and purity through weighing, taking IR and NMR spectrums, and determining the melting point. Thin Layer Chromatography was used to ensure the completion of the final reaction from p-aminobenzoic acid to benzocaine. The yield of the first step from p-toluidine to N-acetyl-p-toluidine was 91.9%. The yield of the second step from N-acetyl-p-toluidine to p-acetamidobenzoic acid was 49.85% The yield of the third step from p-acetamidobenzoic acid to p-aminobenzoic acid was 32.49%, which was not enough to continue so some product was borrowed…

    • 878 Words
    • 4 Pages
    Improved Essays