Reading...
Play button
Play button
Use LEFT and RIGHT arrow keys to navigate between flashcards;
Use UP and DOWN arrow keys to flip the card;
H to show hint;
A reads text to speech;
163 Cards in this Set
- Front
- Back
|
The study of physiological mechanisms that allow the body to recognize materials as foreign and eliminate or neutralize them
|
immunology
|
|
|
Goldilocks concept of immune system
|
inadequate response - porridge too cold
- results in localized or systemic infection or disease with risk of overwhelming infection and/or malignant disease... immunodeficiency, for instance HIV, or Immunosuppressive meds Excessive response - porridge too hot - hypersensitiveity states, auto-immune disease Appropriate response - porridge just right -protects from infection and disease |
|
|
Recognition of self and non-self
|
Self - own cells
Non-self - foreign cells Antigen - a foreign substance which triggers an immune response Antibody - proteins which recognize antigens, bind to specific antigens and tag them for destruction Non-self –example, tissue graft rejection Respond to harmless foreign substances –example, allergy |
|
|
Structure of lymph system
|
Lymphoid Tissues - Network of cells, tissues, organs that work together to defend the body against “foreign” invaders
Cells, tissues & organs positioned throughout the body Primary & secondary lymphoid organs/tissues |
|
|
Primary and secondary lymphoid tissues
|
Primary Lymphoid tissue
Central sites of all cells in immune system Bone Marrow (B-Cell) Thymus (T-Cell) Secondary/Peripheral Lymphoid tissue At or near possible portals of entry for pathogens Spleen Local lymph nodes Tonsils Adenoids Peyer’s patches MALT (mucosal associated lymphoid tissue from from mouth to rectum) |
|
|
Lymph nodes
|
Immune cells and foreign particles enter lymph nodes via lymphatic vessels.
Lymphocytes exit lymph nodes through outgoing lymphatic vessels. Once in the bloodstream, lymphocytes are transported to tissues throughout the body. They patrol everywhere for foreign antigens, then gradually drift back into the lymphatic system to begin the cycle all over again. |
|
|
Lymphadenitis
vs Lymphadenopathy |
Specific lymph gland/node inflammation; localized infection
Generalized lymph gland/node inflammation; caused by more system disease/condition |
|
|
Immune Cells
|
The immune system stockpiles a huge arsenal of cells, including lymphocytes, cell-devouring phagocytes and their relatives.
Lymphocytes B Lymphocytes T Lymphocytes Phagocytes Neutrophils Monocytes Macrophages Release inflammatory mediators Basophils Mast Cells Eosinophils Sometimes immune cells communicate by direct physical contact, and sometimes they communicate releasing chemical messengers |
|
|
B-cells
|
B cell encounters kind of antigen that triggers it to become active, it gives rise to many large cells known as plasma cells, which produce antibodies.
Each B cell programmed to make a single type of antibody For example, one B cell will make an antibody that blocks virus causes common cold, while another produces antibody attacks a bacterium causes pneumonia. When these free-floating antibodies encounter an antigen, they tag it for destruction by phagocytes and complementary proteins. Extracellular toxins and pathogens Unable to detect pathogens or toxins located inside of a cell - cannot penetrate cell |
|
|
Plasma cells
|
Each plasma cell descended from a given B cell makes millions of identical antibody molecules and pours them into bloodstream. Plasma cells are antibody factories.
|
|
|
T-lymphocytes - t-cells
|
T cells are non-antibody-producing lymphocytes
Do not recognize free floating antigens Specialized receptors for antigens on infected or cancerous cells Two Roles in Immune Defense Direct & regulate immune response -Helper T Cells Directly attack infected or cancerous cells -Cytotoxic “Killer” T Cells |
|
|
Helper T-Cells (CD4+ cells)
|
Coordinate immune responses by chemical communication with other cells - cytokines
Some stimulate nearby B cells to produce antibodies Others call in phagocytes Others activate other T cells – Cytotoxic T cells (CD 8) |
|
|
“The Killer Ts”
Cytotoxic T Lymphocytes (CD8+) |
Killer T Cells make contact with target cells, deposits granules filled with chemicals that kill cell.
Directly attack cells carrying foreign or abnormal particles on cell surface. Attack cells where virus is hiding. |
|
|
Natural Killer Cells
|
Another lethal lymphocyte
Large granular lymphocytes; granules with potent chemical NK cells travel in blood and lymph to recognize, attack, and kill tumor cells and virally infected cells by causing cells to burst (“lyse”) |
|
|
Phagocytes & Relatives
|
Large WBCs that can swallow and digest microbes and other foreign particles.
Monocytes – circulate in blood Macrophages – in tissues, organs -Scavengers -Chemical mediators Granulocytes –WBC with granules containing Chemicals -Neutrophil -Eosinophil -Basophil -Mast Cell (not a blood cell) -Plasma Cells (cell fragment) |
|
|
Granulocytes
|
Neutrophils
Polymorphonuclear cells (PMN) Uses chemicals to breakdown phagocytosed bacteria Eosinophils Secrete enzymes to kill parasitic worms Basophils Granules of toxic chemicals that can digest foreign microorganisms Mast Cells Inflammation role |
|
|
Cytokines
|
Cells of the immune system communicate with one another by releasing and responding to these chemical messengers.
Secreted by immune cells and act on other cells to coordinate appropriate immune responses Chemical switches Chemical attractors Types of Cytokines Interleukins Interferons Chemokines -Lymphokines -Monokines |
|
|
When challenged by a virus, other microbe, or toxin the immune system has many weapons...
|
Exterior defenses and non-specific interaction with different antigens (Innate Immunity)
Specific interactions with different antigens (Acquired Immunity) |
|
|
Innate Immunity
|
Two lines of defense are involved in innate immunity; non-specific (does not distinguish types of invaders) and non-adaptive (does not “remember” for future encounters)
Skin and Mucous barriers Non-specific inflammatory response to all forms of cell injury or death Characteristic of innate responses – remain unchanged (no adaption, no memory) however often the antigen is encountered. |
|
|
Innate Immunity
Exterior & Biochemical defences |
Exterior defenses
Skin offers 1st and best line of protection Body openings offer unique protection (e.g. lysozyme in tears & saliva, nasal hair, waxy secretions in ear, low pH vaginal secretions, acidic urine, stomach acid) Biochemical Defenses General inflammatory response Phagocytes migrate out of blood and into infected tissue to ingest microorganisms NK cells Neutrophils, eosinophils, basophils, and monocytes |
|
|
3rd line of defense - specific responses - acquired/adaptive immunity!
|
Called into action when nonspecific methods are not enough and infection becomes widespread
Recognition of a specific invader - specificity Repeated cell divisions that form huge lymphocyte populations Differentiation into subpopulations of effectors and memory cells Participating Cells B Cells Macrophages Helper T Cells Cytotoxic T Cells |
|
|
Acquired immunity - humoral immunity
|
Also called immunoglobulin (Ig)-related immunity
Mediated by antibodies present in different humors, or body fluids (e.g. blood, saliva, vaginal fluids) Very effective against organisms that are free floating in the body, easily reached and neutralized Particularly effective in fighting acute bacterial infection Transmittable to another person by inoculation or maternal transmission - breast milk, placenta (passive immunity) B cells coated with immunoglobulin and has receptor that can recognize specific antigen → B cells change to (1) plasma cells & (2) memory B cells Plasma cell produces & secretes into body fluids specific antibody to that antigen Memory cells circulate for a year or longer; responsible for stronger and sustained response to repeated exposure B cell/plasma cell interaction capable of producing 5 types of immunoglobulin antibodies IgG, IgM, IgA, IgD, IgE |
|
|
Acquired immunity: cell-mediated immunity
|
Some organisms (all viruses, some bacteria) hide in cells where antibodies can’t reach them.
Cell-mediated immunity (or cell immunity) = production and activation of T lymphocytes T-cells or T lymphocytes recognize hidden organisms, search & destroy cell by cell Response is slower than humeral -mediated T lymphocytes important for immune tolerance; loss of immune tolerance can result in some autoimmune disease, rejection of transplanted tissue Clinical conditions that compromise T lymphocyte function include HIV, stress, malignancy, general anesthesia, diabetes, immunosuppressive drugs including corticosteroids Cell mediated immunity cannot be transferred to another person |
|
|
Acquired immunity - passive
|
Passive - antibody formed in another host and transferred to an individual
Natural – natural contact with antibody transplacentally Mother to fetus Breast milk Artificial - inoculation of antibody or antitoxin; immune serum globulin |
|
|
Acquired immunity - active
|
Active - person produces own antibodies to the infecting organism
Natural – natural contact and infection with the antigen Environmental exposure Artificial – inoculation of antigen Vaccination table 7-1, p. 242 |
|
|
How long does acquired immunity last?
|
Active Natural
Usually permanent, but may be temporary Active Artificial Usually permanent, but may be temporary Passive Natural Temporary Until antibodies degrade (weeks to months) Passive Artificial Temporary Until antibodies degrade (weeks to months) |
|
|
Read Summary of Immune Response, Ch 7, pp 248-250
|
do it!
|
|
|
Stress-related conditions/disease
|
Stress has powerful influence on body systems with important implications for development or progression of cancer, CV disease, autoimmune diseases and other illnesses
See Table 2-6, p 46 Allergies & sensitivities Anorexia Nervosa Asthma CA - Cancer CVA - Stroke Gastrointestinal ulcers HA -Headache Hypertension MI – Myocardial Infarction Obesity |
|
|
Clinical manifestations of stress response and symptoms
|
STRESS RESPONSE
↑ HR, BP Changes in respiratory system Release glucose, adrenaline ↓Blood clotting time Dilation of pupils ↓peristalsis & GI function ↓immune response STRESS SYMPTOMS Hypertension Chest pain Headache Myalgia, arthralgia, fibromyalgia Allergic responses GI symptoms Depression, anxiety, panic attacks Prolonged fatigue Eating disorders Poor work or school performance Errors in judgment Sleep disturbances |
|
|
Pathways of stress and relaxation
|
Stress or relax ->
Cerebral cortex (thought, memory) Limbic system (emotions) Hypothalamus/pituitary Autonomic nervous system, endocrine system, and neuropeptide system -> change HR, RR Muscle tone Metabolic rate Immune function |
|
|
General info about HIV
|
HIV (human immunodeficiency virus) - viral infection gradually destroys immune system
5 to 10 million children infected with HIV-1 world wide Number of Adolescents with AIDS doubles each year Injection drug use = 50% of new cases In USA MSM = 41 % Most cases in USA are in ages 25-44; although increasing in older populations |
|
|
Overview of HIV and AIDS
|
HIV - Human immunodeficiency virus infection
A viral infection of the immune system resulting in progressive & ultimately profound immune suppression Virus (HIV) causing transmission of AIDS identified in 1986 Later identified two subtypes: HIV-1 – several strains HIV-2 - AIDS in W Africa AIDS -Acquired immune Deficiency Syndrome T4/CD4 cell count below 200/mL Normal = 600 – 1200/mL Numerous opportunistic infections and unusual cancers If untreated, eventually most HIV-infected individuals develop AIDS, a fatal disease; however with current pharmacological management people live longer managing as a chronic disease. |
|
|
Transmission of HIV
|
Transmission- the primary cause of AIDS is the Type 1 retrovirus (HIV-1)
Exchange of bodily fluids (blood, semen, vaginal secretions) Associated with high risk behaviors: 1. Sexual contact 2. Blood (1977-1985) 3. Mother to child 4. Accidental needle sticks 5. Organ transplants HIV is NOT transmitted by: Casual contact eg hugging, touching, tears Sports (sweat) Mosquitoes See Box 7-3 Risk Reduction Behavior for Prevention of HIV Transmission , p 267 |
|
|
Clinical Manifestations of HIV in Adults
Asymptomatic Stage |
Asymptomatic
Seroconversion (becoming HIV+) – laboratory evidence Takes place usually 3-6 weeks following exposure Acute, self-limiting viral-like or mononucleosis-like infection After few months, little virus in blood, only HIV antibodies remain CD4 count is >500 cells/mm3 CD4 cells generally decline at a rate of 40-80 cells/mm3 per year in untreated individuals People who become infected with HIV may have no symptoms for up to 10 years, but can still transmit the infection to others. |
|
|
Early symptomatic HIV infection
|
Early stage CD4 count between 200-500/mm3
Early Symptomatic HIV Progressive loss of immune function Persistent generalized lymphadenopathy Generalized symptoms (eg diarrhea, weight loss, fatigue, night sweats, fevers) Opportunistic infection Dermatological Conditions Herpes Zoster (Shingles) Bacterial pneumonia More than 50% adults in this stage report fatigue that limits physical and recreational activities; unable to attend work or school. |
|
|
Early Symptomatic Stage HIV Infection
CD4 count 200-500 |
The skin and oral lesions seen in the early stage may persist or worsen
Recurrent Herpes simplex lesions Various constitutional symptoms continue, worsen Bacterial sinusitis, bronchitis, or pneumonia may occur Strep. pneumoniae, and Staph. Aureus bacterial pathogens more frequently seen in this group compared with the general population. Cytomegalovirus (CMV) – peripheral neuropathy affecting retina PCP – P. carini Toxoplasmosis – parasitic disease, affects CNS |
|
|
What's pneumocyctosis?
|
Pneumocystosis is an infection of the lungs caused by the microorganism Pneumocystis carinii. Pneumocystosis is almost exclusively seen in individuals whose immune systems have been compromised by AIDS or chemotherapy.
|
|
|
HIV Advanced Disease
AIDS; CD4 count 200 cells/mm3 or less |
Immune system gradually weakens until diagnosed with AIDS CD4 count 50-200
Numerous neurological manifestations – CNS, PNS, Autonomic NS Late stage PCP (Pneumocystis carinii pneumonia), Toxoplasmosis, CMV (Cytomegalovirus) continue or appear for 1st time CNS - HIV or AIDS encephalopathy or HIV-associated dementia PNS - Peripheral neuropathy Extensive dermatologic conditions Malignant Kaposi’s sarcoma MS - AIDS wasting syndrome – musculoskeletal pain & atrophy |
|
|
Medical management of HIV
|
Risk Reduction Behaviors
P 267, Box 7-3 Effective interventions Use of condoms Counseling Abstinence – behavioral changes not maintained Standard AIDS/HIV Precautions for Health Care Workers P 271, Box 7-4 Summary of Standard Precautions Appendix A, pp1669-1674 |
|
|
Treatment of HIV/AIDS
|
No cure yet
Advances in treatment successful in transforming AIDS into manageable chronic illness Preventative therapies – centers on CD4 count and viral load Highly active antiretroviral therapy (HARRT) – CD4 count drops below 500 cells/mm3 Suppresses HIV replication Reduces load of HIV in blood to low and sometimes undectable levels Treatment of opportunistic infections Simplifying drug regimens to improve adherence (once-daily dosing) Alternatives for those in whom current medications have failed Preventing viral rebound Managing wide range of pharmacological side effects |
|
|
HIV and Rehabilitation
PT Practice patterns 4C, 5E, 5G, 6B and others |
Many possible needs-physical fitness, strength training, QOL issues, work simplification, ADLs
CNS & PNS involvement Cognitive, memory Assistive devices, Environmental adaptation Painful myopathy Post-exercise soreness more common - may need longer rest periods between exercises Musculoskeletal Body mechanics Strength training Cardiopulmonary complications Breathing exercises Rib cage mobilization Energy conservation, posture |
|
|
Exercise and HIV / AIDS
|
Exercise can improve or harm immune system
Moderate levels benefit immune system 70-80% HR max, RPE no greater than 14 (Table 12-13-Borg Scale of Perceived Exertion, Ch 12, p 575) Increasing CD4 cells at earlier stages of the disease Prevent muscle wasting Cardiopulmonary benefits Pain relief, improve appetite, improve mood, reduce effects of stress Exercise recommendations for athletes with HIV – Box 7-5, p 274 |
|
|
What is health?
|
The dictionary definition of health
An individual’s ability to function normally in society; A disease-free state “Google it” A healthy state of wellbeing free from disease The absence of disease or injury along with physical, mental, and social well-being. “Wikipedia” - health Health can be defined negatively, as the absence of illness, functionally, as the ability to cope with everyday activities, or positively, as fitness and well-being. In any organism, health is a form of homeostasis. This is a state of balance, with inputs and outputs of energy and matter in equilibrium (allowing for growth). Health also implies good prospects for continued survival. Illness - (sometimes referred to as ill-health or ailment) is a state of poor health. Illness is sometimes considered a synonym for disease. Others maintain that fine distinctions exist between illness and disease. Some have described illness as the subjective perception by a patient of an objectively defined disease. Much more on this topic to our expert in this area – Dirk de Heer Health – more accurate perception as continuum on which wellness is the optimal level of function, and illness may be so unfavorable as to result in death. Health is a dynamic process that varies with changes in interactions between an individual and the internal and external environments. This continuum type of definition recognizes health as an individual’s level of wellness. |
|
|
Nagi Model
|
Disease -> impairments -> Functional limitations -> disability
|
|
|
WHO - International Classification of functioning, disability, and health
|
Health condition -> body structures and functions -> abilities/activity limitation -> participation restriction
|
|
|
Healthy People 2020
|
The Healthy People program has grown in scope and is now an ongoing comprehensive program of public health planning – Healthy People 2010.
Healthy People 2010 – valuable asset to all who work in health care Goals to: Bring better health to all people in this country Eliminate disparities among different segments of the population Gender, race, ethnicity, education, income, disability, sexual orientation, residence in rural areas |
|
|
Levels of disease prevention
|
Preventative medicine categorized as:
Primary Prevention Geared toward removing or reducing disease risk factor, such as health screenings, safety programs for example: Adequate calcium, exercise to prevent osteoporosis Giving up or not smoking to prevent multiple health problems Use of seat belts, helmets Immunizations Secondary Prevention Techniques designed to promote early detection of disease and use preventative measures to avoid further complications, for example: TB skin tests Mammograms. Colonoscopy Tertiary Prevention Aimed at limiting the impact of established disease (eg radiation or chemotherapy to control localized cancer) Involves rehabilitation Goal of tertiary prevention is to return person to highest level of functioning and prevent further or severe disability. |
|
|
Role of PT in Secondary Care
|
Secondary Care
Referred to PT from another health care practitioner for musculoskeletal, neuromuscular, cardiopulmonary, integumentary condition Provide in wide range of settings from hospitals – schools |
|
|
Role of PT in Tertiary Care
|
Tertiary Care
Specialized Settings Transplant services, burn units, PT in ED Specialized Services SCI TBI |
|
|
Can PTs have a role in primary prevention?
|
APTA's Vision 2020 suggests that physical therapists have important role in Primary Prevention.
Prevention and wellness activities Screening programs Promotion of positive health behaviors – “Exercise is Medicine” |
|
|
Infection
|
“Infection is a process in which an organism establishes a parasitic relationship with its host”
Microorganism produces an immune response Then causes cellular damage |
|
|
Colonization of organisms occurs when:
|
Microorganisms are present but do not yet cause symptoms
A person who is colonized may be a carrier and may transmit organism to others, but does not have detectable symptoms. Begins with transmission of infectious organism |
|
|
After transmission there are 3 possible outcomes:
|
After transmission there are 3 possible outcomes:
May contaminate body surfaces where 1st line defenses (intact skin and mucous membranes) prevent further infection May result in subclinical infection with only an immune response elicited and no symptoms. There is a rise in antibody titer, and the infection can be spread to others. May result in clinically apparent infection host-parasite interaction causes cell injury accompanied by one or more clinical symptoms ranges in severity from mild to fatal depending on organism and response and health of host |
|
|
Incubation Period -
|
Period between pathogen enters host (or exposure to an infectious organism), starts replicating and appearance of clinical symptoms. This period may last for days to several months depending on organism and type of disease, sometime referred to as “silent stage”. Appearance of disease symptoms signal end of incubation period.
For example, incubation period of chickenpox is 14-16 days, influenza 1-3 days. Phase during which the pathogen begins active replication without producing recognizable symptoms in the host. Duration varies depending on pathogen (refer to previous slide). Additional factors that can influence the duration of this period include: general health of the host, portal of entry, and infectious dose of the pathogen. |
|
|
Latent Period -
|
the time from infection to communicability or infectiousness
|
|
|
Period of Communicability -
|
Period when organisms can be shed, host can transmit pathogen. Whether the incubation period or latent period is shorter depends on the disease. (determines whether you can be contagious without symptoms or not)
|
|
|
Prodromal Stage
of infectious disease |
Initial appearance of symptoms, although at this stage the clinical presentation is typically constitutional symptoms shared by a number of disease processes.
Mild fever, myalgia, headache, fatigue and vague sense of malaise. |
|
|
Acute Stage of Illness
|
Maximum impact of infectious process corresponding to rapid proliferation and dissemination of pathogen. Symptoms are most pronounced and more specific, typical of the specific pathogen and sites of involvement.
|
|
|
Convalescence Stage
|
Characterized by containment and control of infection, progressive elimination of pathogen, and the ending of symptoms. Duration may be days, weeks or months.
|
|
|
Resolution Stage
of disease |
Complete elimination of pathogen with no residual signs and symptoms of disease.
|
|
|
Clinical Presentation –
|
also referred to as clinical manifestation; clinical appearance, signs and symptoms
Clinical presentation varies based on infectious agent and body system affected (refer to slide above for symptoms associated with various systems) |
|
|
The Chain of Transmission of Infection is described in Chapter 8, pp 303-307.
chain includes... |
Infectious agent
Reservoir Portal of exit Mode of transmission Portal of entry Susceptible host |
|
|
subcelluar, made up only of RNA or DNA nucleus covered with proteins.
The smallest known organisms, completely dependent on host cells and cannot replicate unless they invade a host cell & stimulate it to participate in the formation of additional ___ particles. |
Viruses –
|
|
|
single celled organisms with well defined cell walls that can grow independently on artificial media without need for other cells.
Classified according to shape, response to staining, motility, tendency toward capsulation, capacity to form spores and whether or not oxygen is needed to replicate and develop. |
Bacteria –
|
|
|
single cell unit or group of non-differentiated cells loosely held together and not forming tissue. Cell membranes, rather than cell walls and nuclei are surrounded by nuclear membranes.
Large parasites include roundworms and flatworms. |
Protozoa –
|
|
|
unicellular to filamentous organisms possessing hyphae (filamentous outgrowths) surrounded by cell walls and containing nuclei.
Little cellular specialization and occur as yeasts (single-cell, oval shaped) or molds (organisms with branching filaments) |
Fungi – Fungal disease in humans are called mycoses.
|
|
|
Infectious disease agents
|
Viruses
Bacteria Mycoplasmas Rickettsiae Chlamydiae Protozoa Spirochetes Fungi Yeasts Molds Helminths Mycobacteria Prions |
|
|
Antigenicity -
|
ability of pathogen to generate immune response in the host. The immune response varies depending on site of invasion, volume of pathogenic organisms, dissemination throughout body, extent of damage it causes, and immune status of the patient.
Principle pathogens – pathogens that regularly cause disease in people with intact defense systems Opportunist pathogens - do not cause disease in people with intact host defenses, but cause devastating disease in persons who are immunocompromised |
|
|
Pathogenicity –
|
ability of an organism to cause disease and depends on the ability of the pathogen to multiply and the strength of the pathogen.
Virulence – potency of pathogen in producing severe disease Quantitative measure of pathogenicity |
|
|
Reservoir of infection –
|
can be animal (including human animals), plant, soil, water or food
The reservoir can be a symptomatic or an asymptomatic carrier of the pathogen Example Hepatitis – human acts as a reservoir where the virus can grow, multiply, and shed without the host (reservoir) showing any signs of the disease. |
|
|
Portal of Exit –
|
route a pathogen takes out of an infected host. Generally the site of growth of pathogenic organism. Include secretions and body fluids, like respiratory secretions, blood, semen, tears.
Helpful to know where exits of pathogens are to prevent transmission Common portals of exit Mouth, nose – respiratory infections Feces, saliva – gastrointestinal infections Urethra or genital region – sexually transmitted diseases Needles, bleeding, arthropods – blood-borne diseases |
|
|
Modes of Transmission - Contact
|
Contact
Direct via physical contact (e.g. GI, respiratory, skin wound infections, MRSA) for example, skin to skin Indirectly via passive transfer from inanimate, intermediate object (e.g. transfer of human immunodeficiency virus from source to host via needle stick; or transfer of Giardia protozoa via oral fecal transmission through ingestion of food prepared by carrier) |
|
|
Modes of Transmission - Airborne
|
Airborne
Small pathogens that can remain suspended in the air for several hours, organisms are more durable and can survive a longer length of time when exposed to air before infecting a new host Propelled through coughs or sneezes further than 1 meter or 3 feet from source, typically mucous droplets that remain airborne (e.g. Measles, TB, Shingles) |
|
|
Modes of Transmission - Droplet
|
Larger particles that are propelled approximately 1 meter or 3 feet of source, so close contact is required for transmission
Transmitted by being coughed on, sneezed on or spit on (e.g. influenza; certain forms of meningitis and pneumonia) |
|
|
Modes of Transmission - Vehicle
|
Vehicle
Infectious agents transmitted through medium routinely taken into the body such as food, water and serves as vehicle into many potential susceptible hosts |
|
|
Modes of Transmission - Vector Born
|
Vector Born
Involves insects or animals that act as intermediaries between hosts (e.g. Lyme disease, Creutzfeldt-Jakob disease). |
|
|
Chain of Transmission - Portals of entry
|
– route a pathogen takes to enter a host.
Mucous membranes Respiratory tract – during inspiration/inhalation Gastrointestinal tract –ingestion Genitourinary tract – touching the GU tract Eyes – touching the eyes Skin Broken, opening Natural pores Boring through intact skin (includes hookworm larvae and some fungi) Parenteral – direct deposit of pathogen into body cavities or wounds Pathogen may enter host through ingestion, inhalation, bites, contact with mucous membranes. Many pathogens have preferred portals of entry. Infectious diseases vary as to volume of organisms and duration of exposure required to start infectious process in new host. |
|
|
Chain of Transmission- host susceptibility
|
Each person has their own unique susceptibility and this can vary with time.
Personal characteristics (like age, sex, etc), general health, and behaviors (like drug use, diet, sexual practices) can increase the probability of an infectious disease developing in a host. Other characteristics include: Medications - Immunosuppressive agents and corticosteroids Breaches of body integrity (e.g. tubes, IV’s, etc.) impair defense mechanisms Presence of underlying medical disorders (co-morbidities) that decrease T and B cell mediated function (Decreased immune function) |
|
|
1st line defense
|
Anatomic and physiologic barriers
First-line defense – external (e.g. skin, cilia, mucous membranes, cough, tears, saliva, body fluids.) Normal flora of microorganisms 1st line of defense acts to inhibit the invasion of the pathogens. The pH in body secretions prevent the growth of pathogens. Normal flora are also part of the 1st line defense to help control the replication of potential pathogens. Example: antibiotics destroy normal flora and therefore yeast infections can occur. |
|
|
2nd line defense
|
Anatomic and physiologic barriers
Second-line defense – inflammatory process 2nd and 3rd line defenses include the lymphatic system, leukocytes, and enzymes as part of the internal defenses. 2nd line - inflammation: generalized, local reaction to cell injury to prevent further injury. If this continues for a long time, it can increase tissue susceptibility to further problems |
|
|
3rd line defense
|
Anatomic and physiologic barriers
Third-line defense – immune response 2nd and 3rd line defenses include the lymphatic system, leukocytes, and enzymes as part of the internal defenses. 3rd line - Immune responses are pathogen-specific |
|
|
Criteria and techniques for diagnosis of infectious disease
|
2 criteria: Recovery of probable pathogen or evidence of its presence from the infected sites
Accurate documentation of clinical signs & symptoms (symptomatogology or clinical presentation techniques: Culture Microscopic or visible identification of organisms Serology Antibody titer Direct antigen detection DNA & RNA sequencing Detection of sequences unique to specific single agents |
|
|
Laboratory techniques for diagnosing infectious disease
|
Isolating the organism in culture.
Growth of the microbe from the infected area is considered evidence that the infection is caused by this organism. For example, isolation of streptococcal pneumoniae from sputum in person with pneumonia. Direct visualization of the infecting organism Pathogenic organism visible or viewed by microscopic examination of tissue fluids, such as sputum, urine, pus, cerebrospinal fluid (CSF). Clues produced by the host immune response to specific microorganisms Histopathologic examination (examination of microscopic anatomical changes in diseased tissue) of excised or biopsied tissue may reveal patterns of the host inflammatory response that can help narrow down diagnosis. Detection of specific characteristic changes in host cells Examination under the microscope to determine what the cells look like, and whether they are abnormal ie pneumonia due to CMV (cytomegalovirus). "Cytology" refers to the study of cells. Detection of microbacterial antigen Detection of specific antigens indicates presence of some diseases such as meningitis, hepatits B, some respiratory and urinary tract infections. Molecular biology and gene detection techniques. |
|
|
Treatment of infectious disease
|
Antibacterial agents “antibiotics”
Increasing prevalence of bacteria resistant to effects of antibiotics Antiviral agents Few effective antiretroviral agents until massive development in AIDS treatment Antifungal agents Before antimicrobial agents, surgical removal of infected tissues, organs & limbs only option to prevent death of host Surgical intervention still important option if pathogen resistant to available treatments Drainage of abscess Debridement to clean site Removal |
|
|
Nosocomial infection
|
Acquired during hospitalization
Increased incidence Invasive devices Increased antibiotic use Greater debilitation and illness severity Result in Prolonged hospital stays Increased costs Higher morbidity and mortality More virulent and resistant to treatment Nosocomial infection – hospital acquired infection In US about 5% of all people who are admitted to the hospital acquire an infection Common examples UTI usually because of the Foley Bloodstream infections (from IVs, surgical wound, and pneumonia) Hand washing is easiest and most effective means of preventing nosocomial infections, and is important even when gloves are used! |
|
|
Emergence of antimicrobial resistance
|
Bacteria have evolved numerous mechanisms to evade antimicrobial drugs.
Chromosomal mutations in bacteria are an important source of resistance to some antimicrobial drugs. Acquisition of resistance genes or gene clusters accounts for most antimicrobial resistance among bacterial pathogens. These mechanisms also enhance the possibility of multi-drug resistance. As each new class of antibiotics is developed, resistance eventually develops. |
|
|
Evolution of drug resistance in S. Aureus
|
Introduction of every new class of antimicrobial drug is followed by emergence of resistance.
By the 1950s, penicillin-resistant S. aureus were a major threat in hospitals and nurseries. By the 1970s, methicillin-resistant S. aureus (MRSA) had emerged and spread, a phenomenon that encouraged widespread use of vancomycin. In the 1990s, vancomycin-resistant enterococci (VRE) emerged and rapidly spread; most of these organisms are resistant to other traditional first-line antimicrobial drugs. Enteroccocci are bacteria that are normally present in the human intestines and in the female genital tract and are often found in the environment. These bacteria can sometimes cause infections. Vancomycin is an antibiotic that is often used to treat infections caused by enterococci. In some instances, enterococci have become resistant to this drug and thus are called vancomycin-resistant enterococci (VRE). Most VRE infections occur in hospitals. At the end of the century, the first S. aureus strains with reduced susceptibility to vancomycin (VISA) were documented, prompting concerns that S. aureus fully resistant to vancomycin may be on the horizon. In June 2002 the first case of vancomycin-resistant S. aureus (VRSA) was detected. |
|
|
Control of transmission (of pathogens)
|
Goal for Controlling Transmission: Break chain of transmission at most cost-effective point – greatest number of people can be protected with least amount of resources.
Transmission to new portal of entry can be prevented by environmental disinfection, use of barrier precautions, proper handling food, good hygiene. Decrease host susceptibility through hygiene, avoidance of high risk behaviors, hand washing Comprehensive immunizations decrease host susceptibility; vaccines induce active immunity Drug prophylaxis may prevent certain diseases; usually reserved for people at risk of exposure to dangerous infections (e.g. Health Care Workers exposed to HIV) Lifestyle and environmental (e.g. nutrition, living conditions, sanitation) factors Examples of controlling transmission include: Use of barriers and isolation; standard and specific precautions issued by CDC Standard (terminology replaced universal precautions, used synonymously now) Transmission based precautions defined according to modes of transmission A set of specific procedures according to mode of transmission used in addition to standard precautions procedures. Three types of transmission-based precautions: airborne precautions, droplet precautions, and contact precautions |
|
|
Immunizations for HCWs and hand-washing
|
1996 CDC recommendations for immunization of HCWs
Hepatitis B Influenza Measles, mumps, rubella (MMR) Varicella zoster Hand washing 5 min of washing: clear 99% of bacteria Average wash/rinse in hospital = 10 seconds Dominant hand under washed Encourage co-workers! HCW = Health Care Worker Skin breakdown with frequent hand washing is problematic and increases risk of nosocomial infections. Other options for cleaning hands such as alcohol based cleaners but still hand washing is more effective. Second to immunizations, hand washing is the most effective disease preventing measure. Varicella-zoster virus (VZV) is the cause of chickenpox and herpes zoster (shingles) |
|
|
Focus on these two most common infectious diseases in your readings.
|
Clostridium difficile
Staphalococcus aureus |
|
|
Clostridium difficile
Transmission Risk Factors Clinical Manifestations |
Cause of nosocomial and community-acquired diarrhea
~ 3 million/yr in the US Mortality rate: 1 - 2.5% Incidence: 228 cases per 100,000 persons Rate of acquisition 13% with hospital stays < 2 weeks 50% with hospital stays > 4 weeks C diff is an anaerobic bacteria recognized as occurring exclusively in presence of exposure to antibiotics. Increasing public health issue as a cause of nosocomial and community-based diarrhea. Transmission: fecal-oral Contamination of environment Can survive in hospital rooms for ~ 40 days after d/c Risk factors – host susceptibility Age (65 or older) Antibiotic consumption (leads to overgrowth) With antibiotics Gastric protection is diminished, c diff can flourish Clinical manifestations: diarrhea TED Talk - Rose George Let's Talk Crap |
|
|
Staphalococcal infections
|
Many types of staph species (S. aureus)
13% of all nosocomial and community-acquired infections Most common cause of infection Affects blood, skin, lungs, soft tissue, and joints Transmission: direct contact Risk factors: burns, age, diabetes, immunocompromised People who are colonized > those who are not Enters the body →localized infection → spreads systemically Common sites: heart valves, joints, bones Staphylococcal Infections organism = staphylcoccal aureus (at least 30 different strains) Normally found on skin and so can easily invade deeper tissue Leading cause of nosocomial and community acquired infections; 2 million hospital infections annually Spreads by direct contact with colonized people or surfaces; HCW are often asymptomatic carriers and can shed into non-intact areas of susceptible hosts Risk factors: frequent use of intravascular devices, burns, surgeries, age, diabetes Pathogenesis: starts as localized infection of skin, spreads to bloodstream or lymph system. Common sites for infection are heart valves, joints, bones Clinical manifestations: Vary according to site and type of infection Can include abscess, cellulitis, osteomyelitis, infection of burns/wounds, septicemia, respiratory tract infections, bacterial endocarditis, toxic shock syndrome, food poisoning Accompanied by fever, chills, pain, malaise, typical constitutional symptoms. Prognosis: Good, except antibiotic resistance is increasing Methicillin-resistant Staphylococcus aureus (MRSA) is very resistant to antibiotics; patients often require placement in isolation. |
|
|
What is osteomyelitis?
What causes this condition? How is it treated? What are outcomes associated with this disease? |
I don't know
Infection that spreads to bone |
|
|
Infections with total joint prostheses
|
Due to intra-operative exposure to bacteria
Most commonly S. epidermidis Risk factors: prior surgery, rheumatoid arthritis, corticosteroids, diabetes, advanced age Joint replacement may activate latent infections Treatment: removal of prosthesis, 6-week period of antibiotics, re-implantation Clinical Manifestations: Inflammation ranging in severity, joint pain, erythema, occasional wound drainage Incidence: Not uncommon, occurrence in 1.5% of total joint replacements , decreasing numbers because of improved surgical procedures and prophylactic antibiotics Infections causes loosening of the prosthesis and sepsis Most often a staph pathogen Risk factors: prior surgery at site of prosthesis, corticosteroid therapy, advanced age, co-morbidities such as rheumatoid arthritis (RA) and diabetes. |
|
|
Streptococcal Group A
|
One of the most common bacterial pathogens
Causes many diseases of varying severity Occurs: Site of infection Remote site Transmission: droplet (contact) Examples: strep throat, necrotizing fasciitis, streptococcal myositis Pathogenic organism - streptococcal group A bacteria Causes wide variety of diseases indiverse organ systems ranging from minor skin infections to life-threatening necrotizing fasciitis. Streptococcal myositis is a very rare bacterial infection of muscle with a high mortality. |
|
|
Necrotizing Fascitis
|
Necrotizing fasciitis - Infection of the fascia
Characterized by infectious thrombosis of the vessels passing between skin and deeper circulation Resembles a thermal burn Caused by streptococcal Group A bacteria How is this condition treated? What sorts of outcomes are achieved? |
|
|
Pseudomonas Aeruginosa
|
Pathogen = pseudomonas aerginosa
Common nosocomial pathogen in hospitals and nursing homes, but uncommon in community-acquired infections and in healthy individuals. Pathogenesis: able to avoid inflammatory and immune defenses. This pathogen damages the epithelial cells to allow binding of P. Aeruginosa It produces enzymes and other substances that limit host mucociliary action and phagocytosis, and facilitates tissue invasion Can also invade blood vessel walls producing systemic pathogenic effects which can lead to vascular thormbosis and hemorrhagic necrosis. This is a multisystem pathogen, affecting the CNS, heart valves, lungs, skin, and soft tissue. Pneumonia, wound infections, UTI, sepsis Seen with CF and diabetes, and patients receiving chemotherapy and antibiotics Gives green color to pus Among the most antibiotic-resistant infections P. aeruginosa: very aggressive (see Fig 8-4 p 325) How is this condition treated? What are the outcomes? |
|
|
Viral Infections: Influenza
|
Every year in the US, on average:
5% to 20% of the US population get the flu More than 200,000 people are hospitalized from flu complications ~ 36,000 people die from flu: most deaths are due to bacterial pneumonias secondary to flu Persons at risk include: elderly, residents of chronic health care facilities, people with chronic pulmonary or cardiovascular disease or diabetes mellitus Common, associated with high mortality and morbidity Transmission: droplet |
|
|
Genomics=
|
The study of all of the genetic information of an organism.
|
|
|
Genetics=
|
The study of hereditary traits.
|
|
|
DNA
|
Your DNA is in most body cells (not in red blood cells)
It stretches 3meters long if rolled out, but it is packed in chromosomes in our cells, we have 46 chromosomes (22 pairs, X and Y) Consists of a,c,t,g ‘the letters’ (A-T; C-G) Letters make ‘words’ of triplets ATG GTC AAA TCT, combined words code for proteins |
|
|
TGCCGCGGAACTTTTCGGCTCTCTAAGGCTGTATTTTGATATACGAAAGGCACATTTTCCTTCCCTTTTCAAAATGCACCTTGCAAACGTAACAG
GAACCCGACTAGGATCATCGGGAAAAGGAGGAGGAGGAGGAAGGCAGGCTCCGGGGAAGCTGGTGGCAGCGGGTCCTGGGTCTGGCGGACCCTGA CGCGAAGGAGGGTCTAGGAAGCTCTCCGGGGAGCCGGTTCTCCCGCCGGTGGCTTCTTCTGTCCTCCAGCGTTGCCAACTGGACCTAAAGAGAGG CCGCGACTGTCGCCCACCTGCGGGATGGGCCTGGTGCTGGGCGGTAAGGACACGGACCTGGAAGGAGCGCGCGCGAGGGAGGGAGGCTGGGAGT AGAATCGGGAAAGGGAGGTGCGGGGCGGCGAGGGAGCGAAGGAGGAGAGGAGGAAGGAGCGGGAGGGGTGCTGGCGGGGGTGCGTAGTGGGTG GAAAGCCGCTAGAGCAAATTTGGGGCCGGACCAGGCAGCACTCGGCTTTTAACCTGGGCAGTGAAGGCGGGGGAAAGAGCAAAAGGAAGGGGTGG TGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAG GTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGT TGTCTCCAAACTTTTTTTCAGGTGAGAAGGTGGCCAACCGAGCTTCGGAAAGACACGTGCCCACGAAAGAGGAGGGCGTGTGTATGGGTTGGGTT TGGGGTAAAGGAATAAGCAGTTTTTAAAAAGATGCGCTATCATTCATTGTTTTGAAAGAAAATGTGGGTATTGTAGAATAAAACAGAAAGCATTA AGAAGAGATGGAAGAATGAACTGAAGCTGATTGAATAGAGAGCCACATCTACTTGCAACTGAAAAGTTAGAATCTCAAGACTCAAGTACGCTACT ATGCACTTGTTTTATTTCATTTTTCTAAGAAACTAAAAATACTTGTTAATAAGTACCTAAGTATGGTTTATTGGTTTTCCCCCTTCATGCCTTGG ACACTTGATTGTCTTCTTGGCACATACAGGTGCCATGCCTGCATATAGTAAGTGCTCAGAAAACATTTCTTGACTGAATTCAGCCAACAAAAATT TTGGGGTAGGTAGAAAATATATGCTTAAAGTATTTATTGTTATGAGACTGGATATATCTAGTATTTGTCACAGGTAAATGATTCTTCAAAAATTG AAAGCAAATTTGTTGAAATATTTATTTTGAAAAAAGTTACTTCACAAGCTATAAATTTTAAAAGCCATAGGAATAGATACCGAAGTTATATCCAA CTGACATTTAATAAATTGTATTCATAGCCTAATGTGATGAGCCACAGAAGCTTGCAAACTTTAATGAGATTTTTTAAAATAGCATCTAAGTTCGG AATCTTAGGCAAAGTGTTGTTAGATGTAGCACTTCATATTTGAAGTGTTCTTTGGATATTGCATCTACTTTGTTCCTGTTATTATACTGGTGTGA ATGAATGAATAGGTACTGCTCTCTCTTGGGACATTACTTGACACATAATTACCCAATGAATAAGCATACTGAGGTATCAAAAAAGTCAAATATGT TATAAATAGCTCATATATGTGTGTAGGGGGGAAGGAATTTAGCTTTCACATCTCTCTTATGTTTAGTTCTCTGCATGTGCAGTTAATCCTGGAAC TCCGGTGCTAAGGAGAGACTGTTGGCCCTTGAAGGAGAGCTCCTCCCTGTGGATGAGAGAGAAGGACTTTACTCTTTGGAATTATCTTTTTGTGT TGATGTTATCCACCTTTTGTTACTCCACCTATAAAATCGGCTTATCTATTGATCTGTTTTCCTAGTCCTTATAAAGTCAAAATGTTAATTGGCAT AAATTATAGACTTTTTTTAGCAGAGAACTTTGAGGAACCTAAATGCCAACCAGTCTAAAAATGCAGTTTTCAGAAGAATGAATATTTCATGGATA GTTCTAAATACTAATGAACTTTAAAATAGCTTACTATTGATCTGTCAAAGTGGGTTTTTATATAATTTTCTTTTTACAAATCACCTGACACATTT AATATAGGTTAAAAAATGCTATCAGGCTGGTTTGCAAAGAAAATGTATTACAAAGGCTGCTAAGTGTGTTAAGAGCATACTCATTTCTGTTCTCC AAAATATTTCATAAGGTGCTTTAAGAATAGGTATGTTTTTAAAAGTTAAGTTCCTACTATTTATAGGAACTGACAATCACCTAAAATACCAATGA TTACAAACTTCCTTCTGGCCTTCTGGACTGCAATTCTAAAAGTGTAAAAAACATATTTTCTGCATTAAGTTAGGCAGTATTGCTTAGTTTTCAAA GTGGTAGGCTTTGGAGTCAGATTATTTTGATTCAGATCCTACATCTACTGTTTAGTAGCTCTGTTGCCTGAGGCAGGTCCCTTAACATCTCTGTG TGTGACTTGACCTTTAAAATTTGGAGACTGTCATAGGGGTTAATCCCTTGAGAAAATGAATGTGAAAAGTTAGCCTAATGTTAACTGCTATTATT ATGGATTACCATATTTTCACATTCATCACAGTACATGCACCTTGTTAATATAAGATGCTCAATTCATCTTTGAGTATAATTTTGTGACTCTCAAT CTGGATATGCAATGAGTGGGCCTGTATGAGAATTTAATTTATGAAAAATTGTGTTTCACATGGCCTTACCAGATATACAGGAAACACGTCACATG TTTCTATTGTATGTTGTTAAATGCCTTAGAATTTAACTTTCTGAATAGGATCCCTTCAGTTTGAGAGTCATAAAAGAGTAAAATTATTATGGTAT |
~3,000 bp (0.0001%) of Human Genome Sequence
(you have about 100,000 of these in most of your cells) |
|
|
Genes
|
Gene= ‘the sentences’; instruction manuals for our bodies, the directions for building all the proteins that make our bodies function
We have about 25,000 genes (not 100,000 or 200,000 as Goodman et al. mention) Changes in genes: mutations, deletions, repeats etc. can have adverse effects Encyclopedia of genetic elements: ENCODE |
|
|
The human genome project: 1989-2003
|
The human genome project: 1989-2003
Cost of sequencing an individuals genome: 2003 = 2013 ? ‘Sequencing’ is getting cheaper: We can generate data, but we have little info about how it impacts people’s judgments and behavior |
|
|
Humans share of DNA with each other
Humans share of DNA with a chimp Humans share of DNA with a mouse Humans share of DNA with a fruit fly Humans share of DNA with a banana |
Humans share of DNA with each other
Humans share of DNA with a chimp Humans share of DNA with a mouse Humans share of DNA with a fruit fly Humans share of DNA with a banana |
|
|
From Gene Discovery To Public Health - applying the human genome project
|
T1 T2 T3 T4
From Gene Discovery to Health Application From Health Application to Evidence-based Guideline From Guideline to Health Practice From Practice to Health Impact Less than 3% of published genomics research is T2 and beyond If we take the continuum of activities or steps that take us from bench science to bedside or population application We see a steep downward curve in the science. On track to repeat the same history! Unless we step up & match with applied research agenda. Audaciously suggest that we could change history! TRANSITION: Goal really is to speed application research – shorter time move research to application. |
|
|
Why is genetics even relevant?
|
Most risk clusters in relatively small proportion of population:
use genetics to stratify treatment use genetics in pharmacology genetic predisposition contributes 30% to premature death according to pie chart |
|
|
Most well-known genetic conditions
|
Rare diseases: e.g. Huntington’s
More common: Breast cancer, cystic fibrosis, sickle cell anemia What proportion of breast cancer cases are carriers of BRCA1 or BRCA2? |
|
|
The business side: DTC testing
(genetics) Businesses? Who is getting genetic testing? |
23andMe
Decode Me Navigenics Biggest predictor of physicians prescribing genetic test= consumer requests Currently, most consumers ‘worried well’- highly educated, high income, caucasian FDA regulations? Do you have the right to your genetic information? What are the consequencces? |
|
|
Current state of affairs for genetics
|
Promising applications in some areas, e.g. pharmacology, cost-effectiveness not well known
Genetic information may have little impact on behavior at this point, but there is limited information Future: gene therapy? Could it be like the internet: current applicability unknown, but it may change every aspect of health care in the future? Stay tuned..!! |
|
|
But if you have a brother, sister, parent or child with diabetes, your risk increases by
|
But if you have a brother, sister, parent or child with diabetes, your risk increases by more than 100% (compared to 4 to 16% for the strongest genes)
|
|
|
Top 10 causes of mortality US 2007 (data from 2011)
(how are respiratory diseases ranked?) |
Heart disease 616,067
Cancer 562,875 Stroke (cerebrovascular diseases) 135,952 Chronic lower respiratory diseases 127,924 Accidents (unintentional injuries) 123,706 Alzheimer's disease 74,632 Diabetes 71,382 Influenza and Pneumonia 52,717 Nephritis, nephrotic syndrome 46,448 Septicimia 34,828 |
|
|
Respiratory disease mortality
|
COPD - 71%
Other - 26% Asthma - 3% But, incidence of asthma is very high. Patients might not come for a specific condition, but it will still affect the treatment plan (co-morbidity). |
|
|
Ventilation:
|
Ventilation: ability to move air in and out of the lungs
Affected by pathology of the airways, lungs, chest wall, diaphragm |
|
|
Respiration:
|
Respiration: gas exchange that supplies oxygen to the blood and body tissues and removes carbon dioxide
Affected by pathology of lungs, cardiovascular system and peripheral tissues |
|
|
Oxygen Transport System
Respiratory System Cardiovascular System Body Tissues |
Respiratory System
Moves gas to and from the alveoli (ventilation) Provides for the passage of oxygen and carbon dioxide across the alveolar-capillary membrane (diffusion) Cardiovascular System Transports dissolved gases to and from the lungs and tissues (perfusion) Body Tissues Oxygen consumption and carbon dioxide production (respiration) |
|
|
The respiratory system contains
|
the upper and lower respiratory tracts. Together they work to bring oxygen in from the air and carry it to the lungs, which can then allow movement of the oxygen from the lungs into the bloodstream to be carried throughout the body. The upper respiratory tract includes the nose, pharynx, and larynx.
Note: epiglottis not pictured |
|
|
The lower respiratory tract includes
|
the trachea, and lungs with all of the branches down to the alveoli where gas exchange takes place.
Alveoli: 0.2mm in diameter (about 10-20 times size of a cell, in ‘capillary beds’ Thin membrane, pulmonary arteries bring deoxygenated blood (Deoxygenated blood: darker, more purple) Alveoli fill approximately 75m2 (27x 27 ft!) folded up in little air sacks Approximately 300 million alveoli in each lung Red blood cells have no nucleus (95% of ‘dry-space’ filled with hemoglobin) |
|
|
Process of pulmonary ventilation, aka breathing
|
Large layer of flat muscles: thoracic diaphragm
Breathe in: contracted diaphraghm (arches down) ‘making the volume of the lungs larger (balloon)’ Pressure in lungs goes down (negative pressure) Air flows from high pressure to low pressure=> air flows in (breathing in) When we stop contracting diaphragm, less space, higher pressure, air flows out Air: 21% oxygen 78% nitrogen <1% Carbon dioxide |
|
|
Lung Volumes
|
TV – tidal volume; amount of air normally inhaled and exhaled with each breath during quiet breathing
IRV – inspiratory reserve volume; additional volume beyond normal tidal inspiration ERV –expiratory reserve volume; additional volume of air that can be let out after normal tidal exhalation RV – residual volume; amount of air that remains in the lungs after forced expiratory effort VC = vital capacity; IRV + TV + ERV - maximum amount of air that can be exhaled after maximum inhalation TLC =total lung capacity; VC + RV - maximum volume the lung can expand FRC=functional residual capacity IC= inspiratory capacity Look at picture too |
|
|
Average Lung Volumes in Healthy Adults
|
Volume
Value (liters) In men In women Inspiratory reserve volume (IRV) 3.3 1.9 Tidal volume (VT or TV) 0.5 0.5 Expiratory reserve volume (ERV) 1.0 0.7 Residual volume (RV) 1.2 1.1 Volume Average value (liters) men women Vital capacity (VC) 4.8 3.1 IRV +TV + ERV Functional residual capacity (FRC) 2.2 1.8 ERV + RV Total lung capacity (TLC) 6.0 4.2 IRV + TV + ERV + RV |
|
|
Comparison of lung volumes in normal, obstructive, and restrictive lung situations
|
Restrictive: inspiratory and expiratory reserve volume reduced; IC, VC, FRC and TLC are all lower
Obstructive: expiratory reserve volume reduced; residual volume increased RV, FRC and TLC are higher; VC is lower |
|
|
Oxygen transport deficits
|
Most common condition caused by pulmonary disease or injury:
Hypoxemia: deficient oxygen in arterial blood Caused by respiratory alterations or cardiovascular compromise Can lead to hypoxia (diminished availability of oxygen to the body tissues), can lead to tissue damage or death Caused by diminished ventilation or diffusion Hypoxia: can occur as secondary effects in diseases of other systems Hypoxemia can lead to hypoxia which means a decreased availability of oxygen to the body tissues. |
|
|
Hypoxemia
assessment |
Signs and symptoms of hypoxemia depend on level of oxygenation in the blood
Assess hypoxemia through exercise testing: Determine degree of hypoxemia on exertion Draw arterial blood samples at rest and peak exercise Non-invasive: pulse oximetry Pulse oximetry is a non-invasive method allowing the monitoring of the oxygenation of a patient's hemoglobin. A sensor is placed on a thin part of the patient's body, usually a fingertip or earlobe, or in the case of an infant, across a foot. Light at red (660nm) and infrared (940nm) wavelengths is passed sequentially through the patient to a photodetector. The changing absorbance at each of the two wavelengths is measured, allowing determination of the absorbances due to the pulsing arterial blood alone, excluding venous blood, skin, bone, muscle, fat, and (in most cases) fingernail polish.[1] Based upon the ratio of changing absorbance of the red and infrared light caused by the difference in color between oxygen-bound (bright red) and oxygen-unbound (dark red or blue, in severe cases) blood hemoglobin, a measure of oxygenation (the percentage of hemoglobin molecules bound with oxygen molecules) can be made. |
|
|
Signs and symptoms of pulmonary disease
|
These are signs and symptoms associated with a variety of pulmonary diseases
Cough – defense mechanism in healthy people Persistent dry cough – tumor, congestion, or hypersensitive airways Productive cough with sputum – irritation or infection Hemoptysis – infection, inflammation, abscess, or tumor Dyspnea – indicates inadequate ventilation or insufficient amount of oxygen in arterial blood Caused by diffuse, rather than focal diseases Associated with increased work of breathing, respiratory muscle fatigue Chest pain is usually found in the substernal area over the involved lung field, but can radiate to the cervical and thoracic region, ribs, scapula, or shoulder Pleural pain is a sharp, localized pain which increases with respiratory movement and is relieved by splinting. Cyanosis – can be seen due to Saturation of O2 and amount of circulating hemoglobin Clubbing - Thickening and widening of distal phalanges. It does not always include pulmonary disease, and is seen with conditions that interfere with tissue perfusion. Altered breathing – can include changes in rate, depth, regularity, and effort |
|
|
Diseases of the respiratory system: By symptom, organ, causes? Goodman & Fuller organization:
|
1.1 Infectious & Inflammatory lung disease
Pneumonia, PCP pneumonia, pulmonary TB, lung abscess, pneumonitis, acute bronchitis 1.2 Obstructive lung diseases Chronic bronchitis, emphysema, asthma, bronchiectasis, sleep-disordered breathing, restrictive lung disease, pulmonary fibrosis, systemic sclerosis lung disease, chest wall trauma 1.3 Environmental & Occupational Diseases Pneumoconiosis, hypersensitivity pneumonitis, noxious gases/ fumes/ smoke 1.4 Congenital Disorders Cystic fibrosis 1.5 Parenchymal disorders Atelectasis, pulmonary edema, ARSD (acute respiratory stress syndrome), postoperative respiratory failure, sarcoidosis, lung cancer 1.6 Disorders of the pulmonary vasculature Pulmonary embolism and infarction, pulmonary hypertension, cor pulmonale, collagen vascular disease 1.7 Disorders of the pleural space Pneumothorax, pleurisy, pleural effusion, empyema, fibrosis |
|
|
Organization (of respiratory system) from national PT examination study guide:
|
1. Acute diseases:
Pneumonia, TB, SARS 2. Chronic obstructive diseases: COPD, Asthma, Cystic Fibrosis, bronchiectasis, respiratory distress syndrome (RDS), bronchopulmonary dysplasia 3. Chronic Restrictive diseases: Restriction due to Lung parynchema and pleura; due to chest wall; due to neuromuscular causes 4. Bronchogenic carcinoma Tumor, cancer 5. Trauma Rib fracture, flail chest, pleural injury, lung contusion 6. Miscellaneous Pulmonary edema, pulmonary emboli, pleural effusion, atelectasis |
|
|
Infectious and inflammatory respiratory diseases
|
Pneumonia
Tuberculosis (PCP Pneumonia) |
|
|
Pneumonia
|
Inflammatory process of the lung parenchyma
Begins as an infection in the upper respiratory tract Inflammatory response to an organism Caused by: Bacteria or virus (bacterial or viral pneumonia) Toxic or caustic chemical Aspiration Prevalence 4 to 5 million per year (25% require hospitalization) 7th leading cause of death |
|
|
Pathogenesis of pneumonia
Clinical manifestations |
Healthy people: effective defense
Compromised person Insufficient alveolar macrophages Microorganism multiplies and release toxins Damage bronchial and alveolar-capillary membranes Air exchange blocked Microorganism Viral (50%) Bacterial (30%) Clinical manifestations Hypoxemia, hypercapnea with increasing severity Hacking, productive cough Dyspnea, tachypnea Cyanosis, headache, fatigue, generalized aches and myalgias Fever, chills Chest pain (if pleuritic involvement) Increased white blood cells in bacterial pneumonia (normal for viral pneumonia) |
|
|
Pneumonia diagnosis, treatment, and implications for the PT
|
Diagnosis
Arterial blood gasses to see if enough oxygen is getting into your blood from the lungs Check white blood cell count Gram's stain and culture of your sputum to look for the bacteria or virus that is causing your symptoms CT chest scan Treatment: antibiotics supportive measures, e.g. oxygen therapy or breathing exercises vaccines Implications for the PT: Hygiene (pulmonary and general) Adequate hydration Deep breathing, coughing, airway clearance techniques, positional rotation Prevention: early ambulation in postoperative clients |
|
|
Pulmonary Tuberculosis
prevalence, treatment Cause |
Prevalence: 9 million sicknesses a year
2 million deaths worldwide/ yr In 2009, 11,545 cases in the US (3.8/100,000), (1.7/100,000 US born, 18.7/100,000 foreign born) TB, Malaria, HIV most funded diseases worldwide for developing countries 1/3rd of the worlds’ population are infected with the mycobacterium tuberculosis; Latent TB: Has TB bacteria in his/her body that are alive, but inactive Preventive treatment: Isoniazid (inhibits TBs mycolic acid) Cause: Mycobacterium Tuberculosis Transmitted by air |
|
|
Pulmonary Tuberculosis
Diagnosis Symptoms |
Diagnosis: Tested by a Mantoux skin test, then sputum/ X-ray;
About 5 to 10% of infected persons will develop active TB disease at some time in their lives General symptoms: Unexplained weight loss, Loss of appetite Night sweats, Fatigue Fever, Chills Pulmonary TB: Coughing for 3 weeks or longer Hemoptysis (coughing up blood) Chest pain Primary disease: 10 days-2 weeks; |
|
|
Obstructive diseases
affect... examples |
Obstruction to airflow
Affects mechanical function and gas exchange capabilities of the lungs Emphysema and chronic bronchitis |
|
|
4th leading cause of death in the US
Source: National vital statistics reports; vol 53 no 5. Hyattsville, Maryland: National Center for Health Statistics, 2004 |
COPD
chronic obstructive pulmonary disorder |
|
|
What conditions are in the category of COPD?
|
Chronic bronchitis
Emphysema Asthma (bronchiectasis, sleep-disordered breathing, restrictive lung disease, pulmonary fibrosis, systemic sclerosis lung disease, chest wall trauma) |
|
|
chronic bronchitis
|
Hypersecretion of mucous sufficient to produce a productive cough on most days for at least 3 months/year during 2 consecutive years
|
|
|
Chronic bronchitis affects the bronchioles and bronchus, whereas emphysema affects
|
the distal airways (alveoli).
Bronchitis is the inflammation of the bronchi, the main air passages to the lungs, it generally follows a viral respiratory infection. Symptoms include; coughing, shortness of breath, wheezing and fatigue. Acute bronchitis: usually because of viral infection; chronic bronchitis usually because of smoking |
|
|
Characteristics and process of chronic bronchitis
|
CB is characterized by inflammation and scarring of the bronchial wall lining. This inflammation also leads to increased mucous production due to Hypertrophy and hypersecretion of submucousal glands in large and small bronch, further limiting airflow. The swollen mucous membranes and thick sputum decrease the lumen size and obstruct the airway. This condition starts in the larger airways, but small airways can become more involved as the disease progresses.
Impaired cilliary function reduces mucous clearance and increases susceptibility to infection, which results in even more mucous and inflammatory response. Airways collapse and air is trapped distal to the site of collapse leading to reduced alveolar ventilation, hypoxemia, hypoxia and abnormal ventilation/perfusion ratio Note: perfusion is the process of nutritive delivery of arterial blood to a capillary bed in the biological tissue. (source: national library of medicine) |
|
|
Clinical manifestations of chronic bronchitis
|
Clinical manifestations:
Chronic productive cough Wheezing SOB/DOE Recurrent chest infections Cyanosis Decreased exercise tolerance Chronic productive cough worse in the AM Wheezing occurs as air attempts to move past the obstruction |
|
|
Emphysema
|
Pathologic accumulation of air in the lungs
Destructive changes to alveolar walls Emphysema is a lung disease involving damage to the air sacs (alveoli). There is progressive destruction of alveoli and the surrounding tissue that supports the alveoli. With more advanced disease, large air cysts develop where normal lung tissue used to be. Air is trapped in the lungs due to lack of supportive tissue which decreases oxygenation. |
|
|
Emphysema pathogenesis
|
Disruption in the elastic fiber network
Degradation of elastin Decrease strength of alveoli walls Pockets of air between alveolar spaces and within lung parenchyma Emphysema is characterized with destruction of an elastin protein that normally maintains the structure and strength of the alveolar wall. The destruction of the elastin leads to a enlargement of the alveoli and a loss of the elasticity leading to narrowing of the airways, trapping ait in the distal airways. The obstruction with emphysema is due to tissue changes rather than mucous. Pockets of air between alveolar spaces and within lung parenchyma leading to less functional tissue for gas exchange and an incraese in ventilatory dead space and an increase work of breathing. |
|
|
Emphysema signs and symptoms
|
DOE progressing to SOB at rest
-Tachypnea with long expiration -Accessory muscles use Scant sputum production Barrel-shaped chest wall - Increased subcostal angle with horizontal ribs Thin (cachectic) |
|
|
COPD Diagnostic Tests
|
Changes in pulmonary function tests (spirometry)
Decreased expiratory flow rates Increased residual volume Chest X-ray or CT scan Blood test (arterial blood gas) The best test for COPD is a lung function test called spirometry. This involves blowing out as hard as possible into a small machine that tests lung capacity. The results can be checked right away, and the test does not involve exercising, drawing blood, or exposure to radiation. Using a stethoscope to listen to the lungs can also be helpful. However, sometimes the lungs sound normal even when COPD is present. Pictures of the lungs (such as x-rays and CT scans) can be helpful, but sometimes look normal even when a person has COPD (especially chest x-ray). Sometimes patients need to have a blood test (called arterial blood gas) to measure the amounts of oxygen and carbon dioxide in the blood. |
|
|
Stages of COPD
I: Mild |
FEV1/FVC < 0.70
FEV1 >= 80% predicted FEV= Forced Expiratory Volume in 1 second (first second of FVC); decreases 20-30mm/ year for normal people, 2-3 times as much for people with COPD FVC= Forced Vital Capacity GOLD= Global Initiative for Obstructive Lung Disease “Rather than telling a patient that their lung function is x% reduced, it may have more impact to tell the patient the age they would be for that lung function to be 100% predicted. “ e.g FEV1 for 25 year old female 5ft 6= 3.53L; 3L is ‘lung age of 46 years’ (85% of capacity) 30 year old male 6ft 1= 4.74L; 4L is ‘60 years old’ |
|
|
Stages of COPD
II: Moderate |
FEV1/FVC < 0.70
50% <= FEV1 < 80% predicted FEV= Forced Expiratory Volume in 1 second (first second of FVC); decreases 20-30mm/ year for normal people, 2-3 times as much for people with COPD FVC= Forced Vital Capacity GOLD= Global Initiative for Obstructive Lung Disease “Rather than telling a patient that their lung function is x% reduced, it may have more impact to tell the patient the age they would be for that lung function to be 100% predicted. “ e.g FEV1 for 25 year old female 5ft 6= 3.53L; 3L is ‘lung age of 46 years’ (85% of capacity) 30 year old male 6ft 1= 4.74L; 4L is ‘60 years old’ |
|
|
Stages of COPD
III: Severe |
FEV1/FVC < 0.70
30% <= FEV1 < 50% predicted FEV= Forced Expiratory Volume in 1 second (first second of FVC); decreases 20-30mm/ year for normal people, 2-3 times as much for people with COPD FVC= Forced Vital Capacity GOLD= Global Initiative for Obstructive Lung Disease “Rather than telling a patient that their lung function is x% reduced, it may have more impact to tell the patient the age they would be for that lung function to be 100% predicted. “ e.g FEV1 for 25 year old female 5ft 6= 3.53L; 3L is ‘lung age of 46 years’ (85% of capacity) 30 year old male 6ft 1= 4.74L; 4L is ‘60 years old’ |
|
|
Stages of COPD
IV: Very Severe |
FEV1/FVC < 0.70
FEV1 < 30% predicted or FEV1 < 50% predicted plus chronic respiratory failure FEV= Forced Expiratory Volume in 1 second (first second of FVC); decreases 20-30mm/ year for normal people, 2-3 times as much for people with COPD FVC= Forced Vital Capacity GOLD= Global Initiative for Obstructive Lung Disease “Rather than telling a patient that their lung function is x% reduced, it may have more impact to tell the patient the age they would be for that lung function to be 100% predicted. “ e.g FEV1 for 25 year old female 5ft 6= 3.53L; 3L is ‘lung age of 46 years’ (85% of capacity) 30 year old male 6ft 1= 4.74L; 4L is ‘60 years old’ |
|
|
COPD treatments across the stages
|
Across all stages:
Active reduction of risk factors; influenza vaccination Add short acting bronchodilator (when needed) At stage II: Moderate Add regular treatment with one or more long-acting bronchodilators (when needed); add rehabilitation At Stage III: Severe Add inhaled glucocorticosteroids if repeated exacerbations At Stage IV: Very Severe Add long-term oxygen if chronic respiratory failure Consider surgical treatment |
|
|
Medications used to treat COPD include:
|
Inhalers (bronchodilators) to open the airways, such as ipratropium (Atrovent), tiotropium (Spiriva), salmeterol (Serevent), formoterol (Foradil), or albuterol
Inhaled steroids to reduce lung inflammation Anti-inflammatory medications such as montelukast (Singulair) and roflimulast are sometimes used In severe cases or during flare-ups, you may need to receive: Steroids by mouth or through a vein (intravenously) Bronchodilators through a nebulizer Oxygen therapy Assistance during breathing from a machine (through a mask, BiPAP, or endotracheal tube) Antibiotics are prescribed during symptom flare-ups, because infections can make COPD worse. |
|
|
Exercise and treatments for COPD
|
Pulmonary rehabilitation does not cure the lung disease, but it can teach you to breathe in a different way so you can stay active. Exercise can help maintain muscle strength in the legs.
Walk to build up strength. Ask the doctor or therapist how far to walk. Slowly increase how far you walk. Try not to talk when you walk if you get short of breath. Use pursed lip breathing when breathing out (to empty your lungs before the next breath) |
|
|
Things you can do to make it easier for yourself (someone with COPD) around the home include:
|
Things you can do to make it easier for yourself around the home include:
Avoiding very cold air Making sure no one smokes in your home Reducing air pollution by getting rid of fireplace smoke and other irritants Eat a healthy diet with fish, poultry, or lean meat, as well as fruits and vegetables. If it is hard to keep your weight up, talk to a doctor or dietitian about eating foods with more calories. Surgery may be used, but only a few patients benefit from these surgical treatments: Surgery to remove parts of the diseased lung can help other areas (not as diseased) work better in some patients with emphysema Lung transplant for severe cases |
|
|
Implications for the PT
For pulmonary conditions in general: |
For pulmonary conditions in general:
QUIT SMOKING, nutrition, weight control, psychosocial support Activities for increasing functional abilities Breathing exercises Postsurgical care Secretion removal techniques Postural drainage Percussion Shaking Airway clearance techniques |
|
|
A 62-year old patient has COPD. Which of these pulmonary test results will not be increased when compared to those of a healthy 62-year old?
1. Total Lung Capacity (TLC) 2. FEV1/FVC (forced vital capacity) ratio 3. Residual Volume (RV) 4. Functional Residual Capacity (FRC) |
2. FEV1/FVC (forced vital capacity) ratio
|
|
|
Asthma definition
Prevalence pathogenesis |
Definition: increased reactivity of the trachea and bronchi to various stimuli (allergens, exercise, cold)
Prevalence: 300+ million worldwide; 34 million in US (11%!) Pathogenesis: widespread narrowing of the airways due to inflammation Muscle constriction, bronchospasms Increased secretions During an asthma attack smooth muscles located in the bronchioles of the lung constrict and decrease the flow of air in the airways. The amount of air flow can further be decreased by inflammation or excess mucus secretion. |
|
|
Common triggers for asthma
|
Common triggers:
Animals (pet hair or dander) Dust, pollen Changes in weather (most often cold weather) Chemicals in the air or in food Exercise (Exercise Induced Asthma) Mold Pollen Respiratory infections, such as the common cold Strong emotions (stress) Tobacco smoke |
|
|
Symptoms and diagnosis of asthma
|
Symptoms:
Wheezing, crackles, decreased breath sounds Increased secretions of variable amounts Dyspnea, tachypnea, tachycardia Hypoxemia, cyanosis Anxiety Diagnosis: Impaired flow rates X-ray can show hyperlucency and flattened diaphragm during exacerbation (Hyperlucency= one lung is less dense than the other normal lung, as from infection or a bronchial foreign body) |
|
|
Treatment of asthma
|
Treatment:
avoid the substances that trigger symptoms control airway inflammation Control drugs to prevent attacks Inhaled corticosteroids (e.g. Asmanex, Alvesco, Qvar AeroBid, Flovent, Pulmicort) prevent symptoms by helping to keep airways from swelling Long-acting beta-agonist inhalers also help prevent asthma symptoms Quick-relief drugs for use during attacks Short-acting bronchodilators (inhalers), such as Proventil, Ventolin, and Xopenex Oral steroids (corticosteroids) when you have an asthma attack that is not going away. |
|
|
What causes cystic fibrosis
|
CF is an inherited disorder of sodium and chloride transport. This leads to chronic bacterial airways infections, obstructive lung condition, progressing to a loss of lung function and fibrosis of the lungs with restriction in lung volume and function.
Abnormality in the CF transmembrane conductance regulator (CFTR) protein. In healthy people, CFTR provide a channel for chloride to move from the plasma into epithelial cells. People with CF have a defective copy of the gene that causes cells to create this chloride channel. As a result, salt accumulated in the cells lining the lungs, gut, pancreas, and reproductive organs making the mucous abnormally thick and sticky. Other mechanisms? Not yet discovered |
|
|
Incidence and cause of cystic fibrosis
|
Incidence: 1 in 3,500 live births
Autosomal recessive trait Mutation at a single gene locus on chromosome 7 Abnormality in CFTR - regulates the transport of chloride across epithelial cell membranes Other mechanisms? |
|
|
Pathogenesis of cystic fibrosis
|
Increased viscosity of mucous
Elevation of sweat electrolytes Pancreatic enzyme deficiency In the lungs: Thick secretions Affects all airways Bacterial infections Staphylococcus aureus Pseudomonas aeruginosa Progress to bronchiectasis, COPD, fibrosis The impermeability of the epithelial cells to chloride results in Increased viscosity of mucous in all mucous producing organs (lungs, pancreas, intestines sweat glands, and reproductive organs). In the lungs, this affects all airways – lung disease starts in the small airways, but damage spreads to large airways until all conducting airways are involved Bacterial infections Staphylococcus aureus initially and then Pseudomonas aeruginosa usually colonnized |
|
|
Diagnosis of cystic fibrosis
|
Genetic counseling
Screening of carriers Sweat test Clinical signs Failure to thrive Respiratory compromise |
|
|
Respiratory implications of cystic fibrosis
|
Clinical manifestations
Sputum production Chronic, productive cough Increased RR and work of breathing Fever and leukocytosis Digital clubbing Treatment – physical therapy, pharmacologic, nutrition, transplant Prognosis Median survival – late 30’s Decrease in pulmonary function over time > 98% die of pulmonary complications Respiratory clinical manifestations Sputum production with is thick making it difficult t expectorate and therefore provides a good medium for bacterial growth 98% of CF patients die or respiratory failure or pulmonary complications |
