Pacific Biosciences

Improved Essays
Pacific Biosciences is the manufacturer that develops comprehensive solution for the used if scientist that stimulate the field of genomics. They also stimulate the field of genomics, improve in science and its research and create positive impact through globally. PacBio also contribute in resolving complex genetic challenges by revolutionized the methods. PacBio tried to develop a new novel technology that is able to push the boundaries of the sequencing in order to overcome the challenges in the field of genomics. PacBio RS II is a Single Molecule Real-Time (SMRT) DNA Sequencing System that gives the highest accuracy and longest read length of the available sequencing technology. PacBio RS II was commercially released in April 2013. PacBio …show more content…
In this new technology, there are two approaches involve which are phospholinked nucleotides and Zero Waveguide (ZMW). The sequencing begins with a single DNA polymerase is immobilized at the bottom of a reaction cell and the reaction called a ZMW (Zero Mode Waveguide). DNA is replicated by enzymes called DNA polymerase which is efficiently duplicate the entire genomes in minutes by reading the DNA and sequentially building a complementary with matching building blocks called nucleotides. DNA polymerase bound to the DNA template is anchored to the bottom glass surface of ZMW. In this sequencing, a phospholinked dNTP is used and each dNTP contains a different fluorophore. During sequence, a single labelled dNTP enters the polymerase. In order to visualize polymerase activity, a different coloured fluorescent label is attached to the four nucleotides, A, C, G and T. Fast bowling nucleotides carry their fluorescent label on the terminal phosphate rather than the base. Indeed, through this innovation, the enzyme cleaves away the fluorescent label as part of the incorporation process.
In detection and sequence determination, the fluorescence signals for each ZMW are collected. Data is collected as a movie of the sequential signals and each individual signal is measured as a short pulse of light. Laser light travelling through the glass into the ZMW illuminates only the lower 30 nm of it since the ZMW dimensions are smaller than the wavelength of the light. This allows the selective excitation and identification of light emitted from nucleotides recruited base elongations that are being held by the polymerase for fractions of

Related Documents

  • Decent Essays

    Nt1310 Lab 6.1

    • 408 Words
    • 2 Pages

    By having a thicker gel, smaller segments can move better and not be cleared out by bigger segments. Polymerase Chain Reaction (PCR) is used to replicate DNA. In Lab 5, we created PCR amplicons by collecting our own DNA through our cheek cells, adding Taq DNA polymerase, dNTPs, primer, and a proper buffer solution into a PCR tube.…

    • 408 Words
    • 2 Pages
    Decent Essays
  • Improved Essays

    Ap Biology Lab Report

    • 711 Words
    • 3 Pages

    The purpose of this lab is to examine cross sections from the leaves of C3 and C4 plants and to determine the morphological differences between them while relating those differences to their metabolism. In C3 plants the carbon dioxide is first incorporated into a 3-carbon compound. Their stomata are open during the day and photosynthesis takes place throughout the mesophyll cells. In comparison C4 plants, the CO2 is first incorporated into a 4-carbon compound. Their stomata are open during the day and photosynthesis takes place within the inner cells.…

    • 711 Words
    • 3 Pages
    Improved Essays
  • Superior Essays

    PCR is used to magnify the 16S rRNA gene and is used in molecular biology to make thousands of copies of the magnified DNA. There are three main stages that the PCR carries out, the first is denaturing when the double-stranded DNA is separated into two strands. Second, annealing which enables the DNA primers to attach to the DNA when the temperature is lowered. Lastly, extending which is when a new strand of DNA is created by the Taq polymerase enzyme when the temperature is raised. This process is run in cycles 29 times and takes approximately 4 hours to complete.…

    • 1419 Words
    • 6 Pages
    Superior Essays
  • Decent Essays

    2.8 Gel Electrophoresis Gel Electrophoresis is a method used in the laboratory to separate compounds of DNA or RNA based on molecular size. The nucleic acid molecules are placed in a gel that contains small pores. With the negative charged nucleic acid, it travels towards the positive electrode. During the travel the molecules are separated whilst travelling through the small gel pores. The nucleic acid travels in the gel at the speed that is inversely related with its size.…

    • 100 Words
    • 1 Pages
    Decent Essays
  • Improved Essays

    When this sugar is present, the pGlo promoter will be turned on, and when it is absent, the promoter will be turned off. Therefore, based on which plate displayed the fluorescent phenotype, the plasmid can be…

    • 393 Words
    • 2 Pages
    Improved Essays
  • Improved Essays

    After cooling to 60°C, 1X GelRed (Biotium) was added, and the solution was poured into a gel casting tray with a 15-lane comb. Once the gel had set, it was placed in the running apparatus (Bio-Rad) and submerged with 1X TAE buffer. DNA samples were prepared for loading by adding 1X DNA loading buffer (Fermentas, Life Technologies, 10mM Tris-HCl (pH7.6), 0.03% bromophenol blue, 0.03% xylene cyanol, 60% glycerol, 60mM EDTA). A 1kb ladder was loaded first followed by the DNA samples. The gel was operated at 100 volts for 30 minutes, and the results were visualized using a UV transilluminator (Kodak EDAS 290).…

    • 742 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Mullis developed polymerase chain reaction ( PCR), which rapidly copies even tiny amounts of DNA for testing; that process enabled scientists to use extremely tiny and/or degraded samples of DNA for forensic purposes. PCR also allowed scientists to diagnose hereditary and infectious diseases, prove paternity, and develop the genetic enhancement and cloning of plants and mammals. In 2003, the Human Genome Project was finally able to announce the mapping of an entire Human Genome ( the entire length of human DNA containing more than 3 Billion base pairs) with an accuracy of 99.99 percent.("DNA…

    • 1057 Words
    • 5 Pages
    Improved Essays
  • Improved Essays

    The agarose gel is poured onto a plastic plat forming wells, and then DNA samples are placed in small wells. When samples are added to their relative wells, gel and plastic plate are…

    • 1612 Words
    • 7 Pages
    Improved Essays
  • Improved Essays

    Sequencing Essay

    • 1108 Words
    • 5 Pages

    Sequencing the human genome has been a huge scientific project for decades now. Scientists everywhere have been racing to see who can sequence the human genome first. Craig Venter, an intensely…

    • 1108 Words
    • 5 Pages
    Improved Essays
  • Decent Essays

    Bio 101 Research Paper

    • 390 Words
    • 2 Pages

    BIO ARTICLE IN THE OUTLINE Mandy Sanguigni – BIO 101 Infants born prematurely may show less interest in others Written by: Masahiro Imafuku & Myowa-Yamakoshi I. New study conducted at Kyoto University to evaluate effects of premature birth with regards to social communication and autism. A. The belief among doctors and scientists is that infants born prior to full term were at greater risk of autism.…

    • 390 Words
    • 2 Pages
    Decent Essays
  • Improved Essays

    Leroy et al. (2000) used 4 microsatellite primers to characterise Brassica oleracea accessions. Among the 136 reproducible fragments generated, 25 (18.4%) fragments were common for all Brassica, 27 (19.9%) were unique and 84 (61.7%) were phylogenetically informative. Flannery et al. (2006) assessed polymorphisms in Brassica, Arabidopsis, Camelina, Raphanus and Sinapis using 10 plastid SSR primer sets.…

    • 951 Words
    • 4 Pages
    Improved Essays
  • Decent Essays

    Ap Biology Research Paper

    • 604 Words
    • 3 Pages

    When I return to school after summer break I will take AP Biology 2. I enjoyed my experience with Honors Biology so I decided to continue it at a higher level. In order to properly introduce myself I will be discussing my family, my previous science courses, and my purpose and goals in taking this class. I am a only child and have a small family.…

    • 604 Words
    • 3 Pages
    Decent Essays
  • Great Essays

    Vaccine Analysis Case

    • 1323 Words
    • 5 Pages

    Discussion When comparing the banding patterns of the crime scene to those of the suspects, the resulting gel indicates that Suspect 2 was at the scene of the crime. Although enzyme 1 produced identical DNA fragments across the gel, enzyme 2 did not. This is evident in lane D and possibly indicates that this enzyme was unable to bind to recognition sites similar to the crime scene DNA in well B. Thus, it produced a DNA fragment smaller in size that travelled further. Since the DNA evidence in well D belongs to Suspect 1, it is apparent that they are not related to the crime.…

    • 1323 Words
    • 5 Pages
    Great Essays
  • Great Essays

    After completing a series of washes, students quantified the amount of DNA in their sample using the NanoVue Spectrophotometer. Using their results from the NanoVue, students were able to determine the amount of their sample DNA and PCR master mix they needed to add to PCR tubes. Then, the samples were loaded into the PCR machine to amplify DNA samples. Once the PCR cycle was complete, samples were stored in a freezer at -20⁰C. With the products from PCR, students used Gel Electrophoresis to separate electrically charged molecules. Gel Electrophoresis requires 3 steps; preparing a gel solution, gel electrophoresis, and photographing the gel.…

    • 1855 Words
    • 8 Pages
    Great Essays
  • Improved Essays

    Results Primer design and LAMP reaction Among 40 different primers (OPA 1-20 & OPB 1-20 series) screened by RAPD PCR for differentiating the Mycosphaerella eumusae from other leaf spot causing fungal pathogens in banana, only the primer OPB 10 has generated a unique amplicon specific to M. eumusae at 1300 bp size. A total of nine different sets of LAMP primers were designed based on this specific SCAR derived RAPD marker sequence of M. eumusae and screened for the production of LAMP products (Fig. 1). Out of nine sets of primer screened, only one set of forward and backward inner primers viz. , FIP1L-GTCTGGAAGCACGCCAATCTGT-TACTTGAAGGCATGCACCAC and BIP1L- TTCGCAACCTCATCGACGTTGT-TCCAGTACTCATTGGCCTCC along with outer primers F3- GCTCGAGCGAAGATGAAAGT and B3- AGCTGCACCAGAATGTTCTTC specifically detected the target DNA (Table 3) by turning the color of LAMP amplified products from orange to yellowish green color.…

    • 1752 Words
    • 8 Pages
    Improved Essays